(±)-Pinoresinol is a potent antifungal agent. (±)-Pinoresinol shows antifungal activity[1].
Influenza A NP(366-374) Strain A/PR/8/35 is an H2-Db-restricted epitope from Influenza A/PR/8/35 nucleoprotein[1].
6-Chloro-7-deazapurine-2F-β-D-arabinofuranose is a nucleoside derivative. 6-Chloro-7-deazapurine-2F-β-D-arabinofuranose can be used for synthesis of antiviral agent against hepatitis C virus infection[1].
Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) hydrate is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM[1].
Oseltamivir-acetate is an impurity of Oseltamivir. Oseltamivir is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B[1][2].
2,5-Dihydroxybenzaldehyde (Gentisaldehyde) is a naturally occurring antimicrobial that inhibits the growth of Mycobacterium avium subsp. paratuberculosis. 2,5-Dihydroxybenzaldehyde is active against S. aureus strains with a MIC50 of 500 mg/L[1][2].
Hecogenin is a steroid saponin isolated from Agave sisalana and is a selective inhibitor of human UDP-glucuronosyltransferases. Hecogenin has a wide spectrum of pharmacological activities, including anti-inflammatory, antifungal and gastroprotective effects[1].
Brilacidin tetrahydrochloride (PMX 30063 tetrahydrochloride) is an anti-infective antimicrobial with MIC90s of 1 and 8 μg/mL for Gram-positive bacteria Streptococcus pneumonia and Streptococcus viridans, and MIC90 of 8 and 4 μg/mL for Gram-negative bacteria Haemophilus influenza and Pseudomonas aeruginosa. Brilacidin tetrahydrochloride is a defensin mimetic antibiotic compound[1][2].
Methylene blue (Basic Blue 9) hydrate is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue hydrate through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue hydrate is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue hydrate is a Tau aggregation inhibitor. Methylene blue hydrate reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation[1][2][3].
Sulfisomidin is a sulfonamide antibacterial.
Topazolin is a flavone. Topazolin has weak fungi-toxic activity against Cladosporium herbarum AHU 9262[1].
Onradivir monohydrate is a potent anti-influenza virus agent[1].
Pseudin-2, an AMP thast could be isolated from the skin of the South American paradoxical frog Pseudis paradoxa, exert a potent growth inhibitory effect against Gram-negative bacteria[1].
Methyl paraben-d4 is the deuterium labeled Methyl Paraben[1]. Methyl Paraben, isolated from the barks of Tsuga dumosa the methyl ester of p-hydroxybenzoic acid, is a standardized chemical allergen. Methyl Paraben is a stable, non-volatile compound used as an antimicrobial preservative in foods, drugs and cosmetics. The physiologic effect of Methyl Paraben is by means of increased histamine release, and cell-mediated immunity[2].
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
Febrifugine is a quinazolinone alkaloid found in the roots and leaves of Dichroa febrifuga, with antimalarial activity [1].
Darunavir(TMC114) is an HIV protease inhibitor.IC50 Value: Target: HIV ProteaseDarunavir HIV-1 antiviral structurally is similar to amprenavir and it is second generation HIV-1-protease inhibitor. Darunavir is a drug used to treat HIV infection. It is in the protease inhibitor class. Prezista is an OARAC recommended treatment option for treatment-naive and treatment-experienced adults and adolescents.
FPI-1602 is a β-lactamase inhibitor. FPI-1602 displays marked antimicrobial activity against P. aeruginosa, E. coli, and Enterobacter spp.[1].
Finafloxacin is a fluoroquinolone antimicrobial agent that exhibits optimum efficacy in slightly acidic environments.
Beauvericin is a Fusarium mycotoxin. Beauvericin inhibits acyl-CoA: cholesterol acyltransferase (ACAT) activity with an IC50 of 3 μM in an enzyme assay using rat liver microsomes[1].
NITD-2, a dengue virus (DENV) polymerase inhibitor, inhibits the DENV RdRp-mediated RNA elongation. NITD-2 penetrates cell membrane poorly[1].
Z-LVG-CHN2 is a cell-permeable and irreversible inhibitor of cysteine proteinase. Z-LVG-CHN2 is a tripeptide derivative and mimics part of the human cysteine proteinase-binding center. Z-LVG-CHN2 displays an inhibition on HSV whereas no significant effect on poliovirus replication. Z-LVG-CHN2 effectively blocks SARS-COV-2 replication (EC50=190 nM) via inhibition of SARS-COV-2 3CL pro protease[3].
(±)9-HpODE is a long chain lipid hydroperoxide, is a product of linoleic acid peroxidation. (±)9-HpODE can induce oxidation of intracellular glutathione (GSH). (±)9-HpODE also exhibits antimicrobial activity against various fungal and bacterial pathogens[1][2].
Sulfathiazole is an organosulfur compound that has been used as a short-acting sulfa drug.Target: AntibacterialSulfathiazole (20 μg/L) starts to be degraded between day 31 and day 38 in one of the two batch reactors containing different wastewater matrices. Sulfathiazole is degraded at a substantially faster rate than sulfamethoxazole or sulfamethazine in the nitrification process (S3) [1]. Recovery from spiked manure slurry samples is 64% for Sulfathiazole at pH 9. Sulfathiazole has acidity constant of pKa of 7.1and retention times (tR) of 7.8. S/N values for Sulfathiazole are above 100 at the 1 mg/kg level [2]. Sulfathiazole sorption to inorganic sorbents exhibits pronounced pH dependence consistent with sorbate speciation and sorbent charge properties. Sulfathiazole cations are most important for sorption to clay minerals, followed by neutral species [3].
Penicillin G benzathine tetrahydrate (Benzathine benzylpenicillin tetrahydrate) is an antibiotic against many bacterial infections[1].
BKI-1369 is a bumped kinase inhibitor (BKI). BKI-1369 increases human Ether-a-go-go-related gene (hERG)-inhibitory activity with an IC50 of 1.52 μM. BKI-1369 reduces the parasite burden and diseases severity in the gnotobiotic pig model. BKI-1369 has been well characterized for potency, stability, metabolism, toxicity, pharmacokinetics and is potent against C. parvum in infected mice and calves[1].
Merafloxacin (CI-934), a fluoroquinolone antibacterial agent, is a selective programmed -1 ribosomal frameshifting (-1 PRF) inhibitor of beta coronaviruses. Merafloxacin exhibits in vitro activity against gram-positive and gram-negative bacteria[1][2].
Octenidine dihydrochloride is an effective antiseptic compound for skin mucous membranes and wounds.
A3N19 is a potent HIV-1 non-nucleoside reverse transcriptase inhibitor, with an EC50 of 3.28 nM against HIV-1 IIIB[1].
2-Ethyl-6-methylphenol, an alkylphenol, is isolated form the tumorigenic neutral subfraction of cigarette smoke condensate. 2-Ethyl-6-methylphenol exhibits insecticidal and bactericidal activities[1][2].