Top Suppliers:I want be here

1403787-62-1

1403787-62-1 structure
1403787-62-1 structure
  • Name: Bepirovirsen
  • Chemical Name: Bepirovirsen
  • CAS Number: 1403787-62-1
  • Molecular Formula:
  • Molecular Weight:
  • Catalog: Signaling Pathways Anti-infection HBV
  • Create Date: 2022-08-16 23:04:04
  • Modify Date: 2025-08-25 16:14:17
  • Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

Name Bepirovirsen
Description Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
Related Catalog
References

[1]. Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734.

No Any Chemical & Physical Properties
The content on this webpage is sourced from various professional data sources. If you have any questions or concerns regarding the content, please feel free to contact service1@chemsrc.com.