Infection is a pathophysiological process that involves the invasion and colonization of a living organism (host) by disease-causing infectious agents, the reaction of host tissues to these agents and the toxins they produce, and the transmission of infectious agents to other hosts. Common infectious agents include viruses, viroids, prions, bacteria, nematodes, arthropods, and other macroparasites such as tapeworms. Hosts can fight infections using their immune system. Mammals often engage both innate and adaptive immune systems to eliminate infectious agents or inhibit their growth and transmission. When infection occurs, anti-infective drugs can suppress the infection. Several broad types of anti-infective drugs exist, depending on the type of organism targeted; they include antibacterial (antibiotic), antiviral, antifungal and antiparasitic agents.


Anti-infection >
Arenavirus Bacterial CMV Enterovirus Filovirus Fungal HBV HCV HIV HSV Influenza Virus Parasite Reverse Transcriptase RSV SARS-CoV
Antibody-drug Conjugate >
ADC Cytotoxin ADC Linker Drug-Linker Conjugates for ADC PROTAC-linker Conjugate for PAC
Apoptosis >
Apoptosis Bcl-2 Family c-Myc Caspase DAPK Ferroptosis IAP MDM-2/p53 PKD RIP kinase Survivin Thymidylate Synthase TNF Receptor
Autophagy >
Autophagy LRRK2 ULK Mitophagy
Cell Cycle/DNA Damage >
Antifolate APC ATM/ATR Aurora Kinase Casein Kinase CDK Checkpoint Kinase (Chk) CRISPR/Cas9 Deubiquitinase DNA Alkylator/Crosslinker DNA-PK DNA/RNA Synthesis Eukaryotic Initiation Factor (eIF) G-quadruplex Haspin Kinase HDAC HSP IRE1 Kinesin LIM Kinase (LIMK) Microtubule/Tubulin Mps1 Nucleoside Antimetabolite/Analog p97 PAK PARP PERK Polo-like Kinase (PLK) PPAR RAD51 ROCK Sirtuin SRPK Telomerase TOPK Topoisomerase Wee1
Cytoskeleton >
Arp2/3 Complex Dynamin Gap Junction Protein Integrin Kinesin Microtubule/Tubulin Mps1 Myosin PAK
Epigenetics >
AMPK Aurora Kinase DNA Methyltransferase Epigenetic Reader Domain HDAC Histone Acetyltransferase Histone Demethylase Histone Methyltransferase JAK MicroRNA PARP PKC Sirtuin Protein Arginine Deiminase
GPCR/G Protein >
5-HT Receptor Adenosine Receptor Adenylate Cyclase Adiponectin Receptor Adrenergic Receptor Angiotensin Receptor Bombesin Receptor Bradykinin Receptor Cannabinoid Receptor CaSR CCR CGRP Receptor Cholecystokinin Receptor CRFR CXCR Dopamine Receptor EBI2/GPR183 Endothelin Receptor GHSR Glucagon Receptor Glucocorticoid Receptor GNRH Receptor GPCR19 GPR109A GPR119 GPR120 GPR139 GPR40 GPR55 GPR84 Guanylate Cyclase Histamine Receptor Imidazoline Receptor Leukotriene Receptor LPL Receptor mAChR MCHR1 (GPR24) Melatonin Receptor mGluR Motilin Receptor Neurokinin Receptor Neuropeptide Y Receptor Neurotensin Receptor Opioid Receptor Orexin Receptor (OX Receptor) Oxytocin Receptor P2Y Receptor Prostaglandin Receptor Protease-Activated Receptor (PAR) Ras RGS Protein Sigma Receptor Somatostatin Receptor TSH Receptor Urotensin Receptor Vasopressin Receptor Melanocortin Receptor
Immunology/Inflammation >
Aryl Hydrocarbon Receptor CCR Complement System COX CXCR FLAP Histamine Receptor IFNAR Interleukin Related IRAK MyD88 NO Synthase NOD-like Receptor (NLR) PD-1/PD-L1 PGE synthase Salt-inducible Kinase (SIK) SPHK STING Thrombopoietin Receptor Toll-like Receptor (TLR) Arginase
JAK/STAT Signaling >
EGFR JAK Pim STAT
MAPK/ERK Pathway >
ERK JNK KLF MAP3K MAP4K MAPKAPK2 (MK2) MEK Mixed Lineage Kinase MNK p38 MAPK Raf Ribosomal S6 Kinase (RSK)
Membrane Transporter/Ion Channel >
ATP Synthase BCRP Calcium Channel CFTR Chloride Channel CRAC Channel CRM1 EAAT2 GABA Receptor GlyT HCN Channel iGluR Monoamine Transporter Monocarboxylate Transporter Na+/Ca2+ Exchanger Na+/HCO3- Cotransporter Na+/K+ ATPase nAChR NKCC P-glycoprotein P2X Receptor Potassium Channel Proton Pump SGLT Sodium Channel TRP Channel URAT1
Metabolic Enzyme/Protease >
15-PGDH 5 alpha Reductase 5-Lipoxygenase Acetyl-CoA Carboxylase Acyltransferase Adenosine Deaminase Adenosine Kinase Aldehyde Dehydrogenase (ALDH) Aldose Reductase Aminopeptidase Angiotensin-converting Enzyme (ACE) ATGL ATP Citrate Lyase Carbonic Anhydrase Carboxypeptidase Cathepsin CETP COMT Cytochrome P450 Dipeptidyl Peptidase Dopamine β-hydroxylase E1/E2/E3 Enzyme Elastase Enolase FAAH FABP Factor Xa Farnesyl Transferase Fatty Acid Synthase (FAS) FXR Glucokinase GSNOR Gutathione S-transferase HCV Protease Hexokinase HIF/HIF Prolyl-Hydroxylase HIV Integrase HIV Protease HMG-CoA Reductase (HMGCR) HSP Indoleamine 2,3-Dioxygenase (IDO) Isocitrate Dehydrogenase (IDH) Lactate Dehydrogenase LXR MAGL Mineralocorticoid Receptor Mitochondrial Metabolism MMP Nampt NEDD8-activating Enzyme Neprilysin PAI-1 PDHK PGC-1α Phosphatase Phosphodiesterase (PDE) Phospholipase Procollagen C Proteinase Proteasome Pyruvate Kinase RAR/RXR Renin ROR Ser/Thr Protease SGK Stearoyl-CoA Desaturase (SCD) Thrombin Tryptophan Hydroxylase Tyrosinase Xanthine Oxidase
Neuronal Signaling >
5-HT Receptor AChE Adenosine Kinase Amyloid-β Beta-secretase CaMK CGRP Receptor COMT Dopamine Receptor Dopamine Transporter FAAH GABA Receptor GlyT iGluR Imidazoline Receptor mAChR Melatonin Receptor Monoamine Oxidase nAChR Neurokinin Receptor Opioid Receptor Serotonin Transporter γ-secretase
NF-κB >
NF-κB IKK Keap1-Nrf2 MALT1
PI3K/Akt/mTOR >
Akt AMPK ATM/ATR DNA-PK GSK-3 MELK mTOR PDK-1 PI3K PI4K PIKfyve PTEN
PROTAC >
PROTAC E3 Ligase Ligand-Linker Conjugate Ligand for E3 Ligase PROTAC Linker PROTAC-linker Conjugate for PAC
Protein Tyrosine Kinase/RTK >
Ack1 ALK Bcr-Abl BMX Kinase Btk c-Fms c-Kit c-Met/HGFR Discoidin Domain Receptor DYRK EGFR Ephrin Receptor FAK FGFR FLT3 IGF-1R Insulin Receptor IRAK Itk PDGFR PKA Pyk2 ROS Src Syk TAM Receptor Trk Receptor VEGFR
Stem Cell/Wnt >
Casein Kinase ERK Gli GSK-3 Hedgehog Hippo (MST) JAK Notch Oct3/4 PKA Porcupine ROCK sFRP-1 Smo STAT TGF-beta/Smad Wnt YAP β-catenin γ-secretase
TGF-beta/Smad >
TGF-beta/Smad PKC ROCK TGF-β Receptor
Vitamin D Related >
VD/VDR
Others >
Androgen Receptor Aromatase Estrogen Receptor/ERR Progesterone Receptor Thyroid Hormone Receptor Others

Chloroorienticin A

Chloroorienticin A (A82846B) is a glycopeptide antibiotic. Chloroorienticin A exhibits excellent activity against staphylococci and streptococci[1].

  • CAS Number: 118395-73-6
  • MF: C73H88Cl2N10O26
  • MW: 1592.44
  • Catalog: Infection
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Epinodosin

Epinodosin is a diterpenoid. Epinodosin has moderate cytotoxicity against HL-60 cells with IC50 value of 10.4 μM. Epinodosin can be used for the research of inflammatory diseases[1].

  • CAS Number: 20086-60-6
  • MF: C20H26O6
  • MW: 362.417
  • Catalog: Infection
  • Density: 1.4±0.1 g/cm3
  • Boiling Point: 615.3±55.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 222.1±25.0 °C

Telavancin

Telavancin (TD-6424) is a semisynthetic lipoglycopeptide vancomycin-derivative, is a novel antimicrobial agent developed by Theravance for overcoming resistant Gram-positive bacterial infections, specifically methicillin-resistant Staphylococcus aureus (MRSA). Telavancin disrupts cell membrane integrity, can be used for research of complicated skin and skin structure infections (cSSSIs) caused by Gram-positive bacteria[1].

  • CAS Number: 372151-71-8
  • MF: C80H106Cl2N11O27P
  • MW: 1755.63000
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Galidesivir triphosphate

Galidesivir triphosphate (Immucillin-A triphosphate) is converted by the prodrug Galidesivir. Galidesivir triphosphate is a substrate for viral RNA-dependent RNA polymerase (RDRP), resulting in termination of viral RNA replication and thus serves as an antiviral. Galidesivir triphosphate inhibits HCV NS5B RNA polymerase activity and protects mice against Ebola[1][2].

  • CAS Number: 1467740-78-8
  • MF: C11H18N5O12P3
  • MW: 505.21
  • Catalog: DNA/RNA Synthesis
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

4,5-Dichlorocatechol

4,5-Dichlorocatechol is a substrate of the broad-spectrum chlorocatechol 1,2-dioxygenase of pseudomonas chlororaphis RW71. The Ki values for 4,5-dichlorocatechol is 30 nM for the dioxygenase of the Chlorobenzoate-degrading strain Pseudomonas putida AC27 and 4 nM for the dioxygenase of Acidovorax sp. strain PS14[1].

  • CAS Number: 3428-24-8
  • MF: C6H4Cl2O2
  • MW: 179.001
  • Catalog: Infection
  • Density: 1.6±0.1 g/cm3
  • Boiling Point: 302.2±37.0 °C at 760 mmHg
  • Melting Point: 110-115ºC(lit.)
  • Flash Point: 136.6±26.5 °C

Gomisin L1

Gomisin M1 ((±)-Gomisin M1) is a potent anti-HIV agent with an EC50 of <0.65 μM[1].

  • CAS Number: 82467-50-3
  • MF: C22H26O6
  • MW: 386.438
  • Catalog: HIV
  • Density: 1.2±0.1 g/cm3
  • Boiling Point: 568.6±50.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 297.7±30.1 °C

(+)-Pinoresinol

(±)-Pinoresinol is a potent antifungal agent. (±)-Pinoresinol shows antifungal activity[1].

  • CAS Number: 4263-88-1
  • MF: C20H22O6
  • MW: 358.39
  • Catalog: Fungal
  • Density: 1.3±0.1 g/cm3
  • Boiling Point: 556.5±50.0 °C at 760 mmHg
  • Melting Point: 144-145℃
  • Flash Point: 290.4±30.1 °C

4-Chloro-7-(2-deoxy-2-fluoro-beta-D-arabinofuranosyl)-7H-pyrrolo[2.3-d]pyrimidine

6-Chloro-7-deazapurine-2F-β-D-arabinofuranose is a nucleoside derivative. 6-Chloro-7-deazapurine-2F-β-D-arabinofuranose can be used for synthesis of antiviral agent against hepatitis C virus infection[1].

  • CAS Number: 169516-60-3
  • MF: C11H11ClFN3O3
  • MW: 287.675
  • Catalog: HCV
  • Density: 1.8±0.1 g/cm3
  • Boiling Point: 548.4±50.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 285.5±30.1 °C

Oseltamivir-acetate

Oseltamivir-acetate is an impurity of Oseltamivir. Oseltamivir is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B[1][2].

  • CAS Number: 1191921-01-3
  • MF: C18H30N2O5
  • MW: 354.44
  • Catalog: Influenza Virus
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Hecogenin

Hecogenin is a steroid saponin isolated from Agave sisalana and is a selective inhibitor of human UDP-glucuronosyltransferases. Hecogenin has a wide spectrum of pharmacological activities, including anti-inflammatory, antifungal and gastroprotective effects[1].

  • CAS Number: 467-55-0
  • MF: C27H42O4
  • MW: 430.620
  • Catalog: Infection
  • Density: 1.2±0.1 g/cm3
  • Boiling Point: 548.9±50.0 °C at 760 mmHg
  • Melting Point: 268°C
  • Flash Point: 177.8±23.6 °C

Brilacidin tetrahydrochloride

Brilacidin tetrahydrochloride (PMX 30063 tetrahydrochloride) is an anti-infective antimicrobial with MIC90s of 1 and 8 μg/mL for Gram-positive bacteria Streptococcus pneumonia and Streptococcus viridans, and MIC90 of 8 and 4 μg/mL for Gram-negative bacteria Haemophilus influenza and Pseudomonas aeruginosa. Brilacidin tetrahydrochloride is a defensin mimetic antibiotic compound[1][2].

  • CAS Number: 1224095-99-1
  • MF: C40H54Cl4F6N14O6
  • MW: 1082.75000
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Bepirovirsen

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Febrifugine

Febrifugine is a quinazolinone alkaloid found in the roots and leaves of Dichroa febrifuga, with antimalarial activity [1].

  • CAS Number: 24159-07-7
  • MF: C16H19N3O3
  • MW: 301.340
  • Catalog: Infection
  • Density: 1.4±0.1 g/cm3
  • Boiling Point: 508.2±60.0 °C at 760 mmHg
  • Melting Point: 139-140°; mp 154-156°
  • Flash Point: 261.1±32.9 °C

FPI-1602

FPI-1602 is a β-lactamase inhibitor. FPI-1602 displays marked antimicrobial activity against P. aeruginosa, E. coli, and Enterobacter spp.[1].

  • CAS Number: 1452460-31-9
  • MF: C11H17N5O7S
  • MW: 363.35
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

NITD-2

NITD-2, a dengue virus (DENV) polymerase inhibitor, inhibits the DENV RdRp-mediated RNA elongation. NITD-2 penetrates cell membrane poorly[1].

  • CAS Number: 1197896-79-9
  • MF: C23H19N3O4S
  • MW: 433.48
  • Catalog: DNA/RNA Synthesis
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Penicillin G benzathine tetrahydrate

Penicillin G benzathine tetrahydrate (Benzathine benzylpenicillin tetrahydrate) is an antibiotic against many bacterial infections[1].

  • CAS Number: 41372-02-5
  • MF: C48H64N6O12S2
  • MW: 981.185
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: 1299.8ºC at 760 mmHg
  • Melting Point: 123-124°C
  • Flash Point: 739.9ºC

A3N19

A3N19 is a potent HIV-1 non-nucleoside reverse transcriptase inhibitor, with an EC50 of 3.28 nM against HIV-1 IIIB[1].

  • CAS Number: 2249755-49-3
  • MF: C31H31N9O2S
  • MW: 593.70
  • Catalog: HIV
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

2-ETHYL-6-METHYLPHENOL

2-Ethyl-6-methylphenol, an alkylphenol, is isolated form the tumorigenic neutral subfraction of cigarette smoke condensate. 2-Ethyl-6-methylphenol exhibits insecticidal and bactericidal activities[1][2].

  • CAS Number: 1687-64-5
  • MF: C9H12O
  • MW: 136.19100
  • Catalog: Bacterial
  • Density: 0.994g/cm3
  • Boiling Point: 209.8ºC at 760mmHg
  • Melting Point: N/A
  • Flash Point: 90.7ºC

Napyradiomycin A1

Napyradiomycin A1 is one enantioselective compound of napyradiomycins. napyradiomycins are an intriguing family of halogenated natural products with activity against several tumor cell lines as well as some bacterial strains[1].

  • CAS Number: 103106-24-7
  • MF: C25H30Cl2O5
  • MW: 481.40900
  • Catalog: Bacterial
  • Density: 1.31g/cm3
  • Boiling Point: 642.5ºC at 760mmHg
  • Melting Point: N/A
  • Flash Point: 342.4ºC

Antimicrobial agent-3

Antimicrobial agent-3 (Compound U10) is an antimicrobial agent against bacterial, fungal and tubercular infections[1].

  • CAS Number: 1902712-34-8
  • MF: C14H11N3OS
  • MW: 269.32
  • Catalog: Bacterial
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

(-)-Quinine dihydrochloride

Quinine dihydrochloride is an orally active alkaloid extracted from cinchona bark and can be used in anti-malarial studies. Quinine dihydrochloride is a potassium channel inhibitor that inhibits WT mouse Slo3 (KCa5.1) channel currents evoked by voltage pulses to +100 mV with an IC50 of 169 μM[1][2].

  • CAS Number: 60-93-5
  • MF: C20H26Cl2N2O2
  • MW: 397.339
  • Catalog: Potassium Channel
  • Density: N/A
  • Boiling Point: 495.9ºC at 760 mmHg
  • Melting Point: 238-2400C
  • Flash Point: 253.7ºC

Ribostamycin sulfate

Ribostamycin is a broad-spectrum antimicrobial, inhibits bacterial protein synthesis at the level of 30S and 50S ribosomal subunit binding, also inhibits the chaperone activity of protein disulfide isomerase (PDI), used in pharmacokinetic and nephrotoxicity studies

  • CAS Number: 53797-35-6
  • MF: C17H36N4O14S
  • MW: 552.551
  • Catalog: Bacterial
  • Density: 1.6g/cm3
  • Boiling Point: 907.6ºC at 760 mmHg
  • Melting Point: 175-180ºC
  • Flash Point: 502.7ºC

HIV-1 protease-IN-9

HIV-1 protease-IN-9 (compound 5b) is a HIV-1 protease inhibitor, with a Ki of 0.028 nM. HIV-1 protease-IN-9 shows potent antiviral activity, with an IC50 of 66.8 nM[1].

  • CAS Number: 2925381-27-5
  • MF: C37H41N7O4S
  • MW: 679.83
  • Catalog: HIV Protease
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

Tulathromycin B

Tulathromycin B (CP 547272) is an isomer of Tulathromycin (a macrolide antibiotic)[1].

  • CAS Number: 280755-12-6
  • MF: C41H79N3O12
  • MW: 806.079
  • Catalog: Bacterial
  • Density: 1.2±0.1 g/cm3
  • Boiling Point: 870.5±65.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 480.3±34.3 °C

Ludaconitine

Ludaconitine, isolated from Aconitum spicatum (Bruhl) Stapf, exhibits antileishmanial activity with an IC50 of 36.10 μg/mL[1].

  • CAS Number: 82144-72-7
  • MF: C32H45NO9
  • MW: 587.70
  • Catalog: Parasite
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

merimepodib

Merimepodib is a novel noncompetitive inhibitor of IMPDH (Inosine monophosphate dehydrogenase).

  • CAS Number: 198821-22-6
  • MF: C23H24N4O6
  • MW: 452.460
  • Catalog: HBV
  • Density: 1.4±0.1 g/cm3
  • Boiling Point: 571.4±50.0 °C at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 299.4±30.1 °C

Dermaseptin-S2

Dermaseptin-S2 is an antimicrobial peptide derived from frog skin against filamentous fungi[1].

  • CAS Number: 151896-13-8
  • MF: C155H255N43O43S2
  • MW: 3473.08
  • Catalog: Fungal
  • Density: N/A
  • Boiling Point: N/A
  • Melting Point: N/A
  • Flash Point: N/A

16-Epiestriol

16-Epiestriol is a metabolite of the endogenous estrogen estrone with antibacterial and anti-inflammatory effects[1][2][3].

  • CAS Number: 547-81-9
  • MF: C18H24O3
  • MW: 288.38100
  • Catalog: Infection
  • Density: 1.255g/cm3
  • Boiling Point: 469ºC at 760 mmHg
  • Melting Point: 289-291ºC
  • Flash Point: 220.8ºC

Florfenicol amine

Florfenicol amine is a metabolite of Florfenicol (HY-B1374). Florfenicol, a veterinary antibiotic, is used in aquaculture to control susceptible bacterial diseases[1].

  • CAS Number: 76639-93-5
  • MF: C10H14FNO3S
  • MW: 247.28600
  • Catalog: Infection
  • Density: 1.313±0.06 g/cm3
  • Boiling Point: 488.7±45.0 °C
  • Melting Point: N/A
  • Flash Point: N/A

Loflucarban

Loflucarban (Fluonilid) is a potent antimycotic agent. Loflucarban can be used for the research of the ear infections[1].

  • CAS Number: 790-69-2
  • MF: C13H9Cl2FN2S
  • MW: 315.19300
  • Catalog: Fungal
  • Density: 1.531g/cm3
  • Boiling Point: 395ºC at 760 mmHg
  • Melting Point: N/A
  • Flash Point: 192.7ºC