Chloroorienticin A (A82846B) is a glycopeptide antibiotic. Chloroorienticin A exhibits excellent activity against staphylococci and streptococci[1].
Epinodosin is a diterpenoid. Epinodosin has moderate cytotoxicity against HL-60 cells with IC50 value of 10.4 μM. Epinodosin can be used for the research of inflammatory diseases[1].
Telavancin (TD-6424) is a semisynthetic lipoglycopeptide vancomycin-derivative, is a novel antimicrobial agent developed by Theravance for overcoming resistant Gram-positive bacterial infections, specifically methicillin-resistant Staphylococcus aureus (MRSA). Telavancin disrupts cell membrane integrity, can be used for research of complicated skin and skin structure infections (cSSSIs) caused by Gram-positive bacteria[1].
Galidesivir triphosphate (Immucillin-A triphosphate) is converted by the prodrug Galidesivir. Galidesivir triphosphate is a substrate for viral RNA-dependent RNA polymerase (RDRP), resulting in termination of viral RNA replication and thus serves as an antiviral. Galidesivir triphosphate inhibits HCV NS5B RNA polymerase activity and protects mice against Ebola[1][2].
4,5-Dichlorocatechol is a substrate of the broad-spectrum chlorocatechol 1,2-dioxygenase of pseudomonas chlororaphis RW71. The Ki values for 4,5-dichlorocatechol is 30 nM for the dioxygenase of the Chlorobenzoate-degrading strain Pseudomonas putida AC27 and 4 nM for the dioxygenase of Acidovorax sp. strain PS14[1].
Gomisin M1 ((±)-Gomisin M1) is a potent anti-HIV agent with an EC50 of <0.65 μM[1].
(±)-Pinoresinol is a potent antifungal agent. (±)-Pinoresinol shows antifungal activity[1].
6-Chloro-7-deazapurine-2F-β-D-arabinofuranose is a nucleoside derivative. 6-Chloro-7-deazapurine-2F-β-D-arabinofuranose can be used for synthesis of antiviral agent against hepatitis C virus infection[1].
Oseltamivir-acetate is an impurity of Oseltamivir. Oseltamivir is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B[1][2].
Hecogenin is a steroid saponin isolated from Agave sisalana and is a selective inhibitor of human UDP-glucuronosyltransferases. Hecogenin has a wide spectrum of pharmacological activities, including anti-inflammatory, antifungal and gastroprotective effects[1].
Brilacidin tetrahydrochloride (PMX 30063 tetrahydrochloride) is an anti-infective antimicrobial with MIC90s of 1 and 8 μg/mL for Gram-positive bacteria Streptococcus pneumonia and Streptococcus viridans, and MIC90 of 8 and 4 μg/mL for Gram-negative bacteria Haemophilus influenza and Pseudomonas aeruginosa. Brilacidin tetrahydrochloride is a defensin mimetic antibiotic compound[1][2].
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
Febrifugine is a quinazolinone alkaloid found in the roots and leaves of Dichroa febrifuga, with antimalarial activity [1].
FPI-1602 is a β-lactamase inhibitor. FPI-1602 displays marked antimicrobial activity against P. aeruginosa, E. coli, and Enterobacter spp.[1].
NITD-2, a dengue virus (DENV) polymerase inhibitor, inhibits the DENV RdRp-mediated RNA elongation. NITD-2 penetrates cell membrane poorly[1].
Penicillin G benzathine tetrahydrate (Benzathine benzylpenicillin tetrahydrate) is an antibiotic against many bacterial infections[1].
A3N19 is a potent HIV-1 non-nucleoside reverse transcriptase inhibitor, with an EC50 of 3.28 nM against HIV-1 IIIB[1].
2-Ethyl-6-methylphenol, an alkylphenol, is isolated form the tumorigenic neutral subfraction of cigarette smoke condensate. 2-Ethyl-6-methylphenol exhibits insecticidal and bactericidal activities[1][2].
Napyradiomycin A1 is one enantioselective compound of napyradiomycins. napyradiomycins are an intriguing family of halogenated natural products with activity against several tumor cell lines as well as some bacterial strains[1].
Antimicrobial agent-3 (Compound U10) is an antimicrobial agent against bacterial, fungal and tubercular infections[1].
Quinine dihydrochloride is an orally active alkaloid extracted from cinchona bark and can be used in anti-malarial studies. Quinine dihydrochloride is a potassium channel inhibitor that inhibits WT mouse Slo3 (KCa5.1) channel currents evoked by voltage pulses to +100 mV with an IC50 of 169 μM[1][2].
Ribostamycin is a broad-spectrum antimicrobial, inhibits bacterial protein synthesis at the level of 30S and 50S ribosomal subunit binding, also inhibits the chaperone activity of protein disulfide isomerase (PDI), used in pharmacokinetic and nephrotoxicity studies
HIV-1 protease-IN-9 (compound 5b) is a HIV-1 protease inhibitor, with a Ki of 0.028 nM. HIV-1 protease-IN-9 shows potent antiviral activity, with an IC50 of 66.8 nM[1].
Tulathromycin B (CP 547272) is an isomer of Tulathromycin (a macrolide antibiotic)[1].
Ludaconitine, isolated from Aconitum spicatum (Bruhl) Stapf, exhibits antileishmanial activity with an IC50 of 36.10 μg/mL[1].
Merimepodib is a novel noncompetitive inhibitor of IMPDH (Inosine monophosphate dehydrogenase).
Dermaseptin-S2 is an antimicrobial peptide derived from frog skin against filamentous fungi[1].
16-Epiestriol is a metabolite of the endogenous estrogen estrone with antibacterial and anti-inflammatory effects[1][2][3].
Florfenicol amine is a metabolite of Florfenicol (HY-B1374). Florfenicol, a veterinary antibiotic, is used in aquaculture to control susceptible bacterial diseases[1].
Loflucarban (Fluonilid) is a potent antimycotic agent. Loflucarban can be used for the research of the ear infections[1].