前往化源商城

115-56-0 靶点实验数据

HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:disintegrin and metalloproteinase domain-containing protein 17 preproprotein [Homo sapiens]
External ID: ADAM17_INH_QFRET_1536_1X%INH PRUN
Protocol: Assay Overview:

The purpose of this assay is to identify compounds that inhibit ADAM17. This assay employs a fluorophore and quencher pair. F =EDANS fluorophore, Q = DABCYL quencher. When intact, EDANS emission at 460nm is quenched by DABCYL via fluorescence resonance energy transfer. Upon cleavage of the scissile bond (A~V) by ADAM protease, the distance between fluorophore and quencher increases resulting in fluorescence increase at 460nm. Compounds are tested in singlicate at a final nominal concentration of 6.95 micromolar.

Protocol Summary:

Prior to the start of the assay, 2.5 microliters 2X ADAM17 enzyme (20 nM in Assay Buffer: 50 mM HEPES, 0.01% Brij, pH 7.5) are dispensed into 1536 microtiter plates. Compounds are added to plate (final concentration TBD) and incubated for 30 minutes at 25 degrees Celsius. The assay is started by dispensing 2.5 microliter of2X DM2 substrate (20 uM in Assay Buffer) to all wells. Plates are centrifuged and after 3 hours of incubation at 25 degrees Celsius, fluorescence is measured (excitation = 359nm, emission = 460nm).

The % inhibition for each well was then calculated as follows:

%_Inhibition = ( RFU_Test_Compound - MedianRFU_Low_Control ) / ( MedianRFU_High_Control - MedianRFU_Low_Control ) * 100

Where:

Test_Compound is defined as wells containing test compound.
High_Control is defined as wells treated with 1 micromolar Marimastat
Low_Control is defined as wells containing DMSO.


Interval Cutoff:
A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Four values were calculated: (1) the average percent inhibition of all high controls tested plus three times the standard deviation of the high controls, (2) the average percent inhibition of all low controls tested minus three times the standard deviation of the low controls, (3) the average percent inhibition of all compounds tested between (1) and (2), and (4) three times their standard deviation. The sum of two of these values, (3) and (4), was used as a cutoff parameter, i.e. any compound that exhibited greater % inhibition/activity than the cutoff parameter was declared active.

PubChem Activity Outcome and Score:

The reported PubChem Activity Score has been normalized to 100% observed primary inhibition. Negative % inhibition values are reported as activity score zero.

The activity score range for active compounds is 100-8, for inactive 8-0.

List of Reagents:

ADAM17 enzyme (R&D Systems, part # 930-ADB)
EDANS-DABCYL DM2 peptide substrate (Supplied by Assay Provider)
0.5M HEPES solution, pH7.5 (Teknova, part #101319-900)
Brij-35 (Sigma-Aldrich, part # P1254)
1536 well plate (Corning, part # 7261)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. In this case the results of each separate campaign were assigned "Active/Inactive" status based upon that campaign's specific compound activity cutoff value. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Inhibition at 6.95 uM
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
1.23
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:muscarinic acetylcholine receptor M1 [Homo sapiens]
External ID: CHRM1_AG_FLUO8_1536_1X%ACT PRUN
Protocol: Assay Overview:

The purpose of this assay is to identify compounds that act as agonists of the human M1 muscarinic receptor (CHRM1; M1). In this assay, CHO-K1 cells stably expressing human M1 are loaded, intracellularly with the calcium indicator dye, Fluo-8, followed by treatment with agonist control or test compounds. As designed, compounds that act as CHRM1 agonists will increase intracellular calcium mobilization, resulting in increased relative fluorescence of the indicator dye and well fluorescence. Compounds are tested in singlicate at a final nominal concentration of 3 uM.

Protocol Summary:

The CHO-hM1 cell line was routinely cultured in T-175 sq cm flasks at 37 C and 95% relative humidity (RH). The growth media consisted of Ham's F-12 Nutrient Media (F-12) supplemented with 10% v/v heat-inactivated qualified fetal bovine serum, 20 mM HEPES, 50 ug/mL Geneticin, and 1X antibiotic mix (penicillin and streptomycin).

The day before the assay 3000 cells in 3 uL of growth media were seeded into each well of 1536 well microtiter plates and allowed to incubate at 37 C, 5% CO2, and 95 % RH for 17-24 hours. Next, 2 uL of the fluorogenic Fluo-8 intracellular calcium indicator mixture (prepared according to the manufacturer's protocol) was added to each well. Plates were then incubated for 1 hour at 37 C, 5% CO2, and 95 % RH, followed by 30 minute incubation at room temperature. Then, 15 nL of test compound in DMSO were dispensed to appropriate wells. The assay was started by performing a basal read of plate fluorescence (470-495 nm excitation and 515-575 nm emission) for 5 seconds on the FLIPR Tetra (Molecular Devices). Then a real time fluorescence measurement was immediately performed for the remaining 140 seconds of the assay. A ratio for each well was calculated to normalize assay data, according to the following mathematical expression:

Ratio = I_Max / I_Min

Where:

I_Max represents the maximum measured fluorescence emission intensity over the 140 second read.
I_Min represents the minimum (basal) measured fluorescence emission intensity before compound was added.

The percent activation was calculated from the median ratio as follows:

%_Activation = ( ( Ratio_Test_Compound - Median_Ratio_Low_Control ) / ( Median_Ratio_High_Control - Median_Ratio_Low_Control ) ) * 100

Where:

Test_Compound is defined as wells containing test compound.
Low_Control is defined as wells containing DMSO.
High_Control is defined as wells containing Acetylcholine (EC100) and DMSO.

PubChem Activity Outcome and Score:

A mathematical algorithm was used to determine nominally activating compounds in the primary screen. Two values were calculated for each assay plate: (1) the average percent activation of test compound wells and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter for the entire run, i.e. any compound that exhibited greater % activation than the entire screen's cutoff parameter was declared active.

The reported PubChem Activity Score has been normalized to 100% observed primary activation. Negative % activation values are reported as activity score zero.

The PubChem Activity Score range for active compounds is 100-1, and for inactive compounds 1-0.

List of Reagents:

Cell line: Chinese Hamster Ovary (CHO) cells containing hM1 receptor; (Conn Lab)
Calcium sensitive dye: Fluo-8 No Wash Calcium Assay Kit; (AAT Bioquest, part 36316)
Growth media: Ham's F-12; 10% FBS, 20mM HEPES, 50 ug/mL G418
Assay media: Ham's F-12, 10% FBS, 20 mM HEPES
Assay plates: Aurora black/clear 1536well FLIPR plate; (Aurora, part 00019326)
Probenecid: 250 mM (pH 8.0); (Sigma P8761)
Agonist: Acetylcholine (50 mM stock in water); Sigma A9187
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, and compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Activation at 3 uM
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
-1.07
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:TDP1 protein [Homo sapiens]
External ID: TDP1100
Protocol: DT40-hTDP1 cells without 20 nM Camptothecin (add 20 microL of DMSO in 1 L of cell culture medium) were dispensed at 400 cells/5microL/well in tissue culture treated 1536-well white wall/solid bottom assay plates (Greiner Bio-One North America, NC, U.S.A.) using a Multidrop Combi 8 channel dispenser (Thermo Fisher, Waltham, MA, USA). 23 nL compounds and controls were transferred using the pin tool (Kalypsys, San Diego, CA, USA) to the assay plates. The assay plates were then incubated at 37 masculineC for a minimum 48 hr. Three microL of Cell Titer Glo solution was added to the plates and incubated at RT in dark for 30 min. Luminescence was read using ViewLux (Perkin Elmer) with 1 sec exposure slow speed, high gain and 2x binning.
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description". For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.
2. For all inactive compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentActivity_ScoreCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.0000295000 uMActivity at 0.0000590000 uMActivity at 0.0001503265 uMActivity at 0.0002712146 uMActivity at 0.0005895491 uMActivity at 0.00117 uMActivity at 0.00179 uMActivity at 0.00299 uMActivity at 0.00672 uMActivity at 0.014 uMActivity at 0.026 uMActivity at 0.040 uMActivity at 0.074 uMActivity at 0.167 uMActivity at 0.363 uMActivity at 0.628 uMActivity at 0.975 uMActivity at 1.849 uMActivity at 4.119 uMActivity at 9.037 uMActivity at 15.83 uMActivity at 21.08 uMActivity at 46.23 uMActivity at 92.54 uMActivity at 165.6 uMCompound QC
Inactive04-3.0662-2.41261.9741-4.0617-0.6298-3.0662QC'd by "Chem Div"
Inactive04.95490.7346-0.808-4.30840 0 0 0 0-0.431-4.3080.8987-1.5892-1.522-0.431QC'd by "Chem Div"
Inactive04.95490.6448-12.51274.558540 0 0 0 0-9.75096.55851.6006-0.810411.697-9.7509QC'd by "Chem Div"
Inhibitor18.356499.037841Partial curve; high efficacy-4.73622.84730.9985-99.5803-0.5425-2.10 0 0 0 0-92.8278-1.5772-1.93651.8258-13.1847-92.8278QC'd by "Chem Div"
Inhibitor29.092942.181510Single point of activity-4.53624.95490.9879-50.8391-8.6577-30 0 0 0 0-46.8496-7.6387-8.6142-11.6103-6.66-46.8496QC'd by "Chem Div"
Inhibitor18.3564123.871841Partial curve; high efficacy-4.73621.62590.9975-121.45782.414-2.10 0 0 0 0-98.82245.0098-1.1767-0.5372-27.2941-98.8224QC'd by "Chem Div"
Inhibitor14.581109.907342Partial curve; high efficacy-4.83621.82650.9637-106.40863.4987-2.10 0 0 0 0-94.670912.0352-9.70946.0901-28.9742-94.6709QC'd by "Chem Div"
Inactive00.30.9096-34.0578-3.769740 0 0 0 0-28.0098-7.7697-15.2699-21.1534-19.3019-28.0098QC'd by "Chem Div"
Inhibitor29.092990.897810Single point of activity-4.53624.44950.9936-90.33680.561-30 0 0 0 0-79.96355.0637-2.1732-1.69030.5114-79.9635QC'd by "Chem Div"
Inactive00.30.426615.2787-6.721340 0 0 0 010.4803-5.72138.5589-5.30466.71910.4803QC'd by "Chem Div"
Inactive01.96730.6089-9.50825.296840 0 0 0 0-7.95747.2968-1.890310.39461.3036-7.9574QC'd by "Chem Div"
Inhibitor16.360145.504710Single point of activity-4.78624.95490.9618-49.1256-3.6209-30 0 0 0 0-48.9315-7.5358-6.3332.7698-6.0371-48.9315QC'd by "Chem Div"
Inactive0-5.28620.80.9747-26.74278.437240 0 0 0 0-20.71279.43722.29650.248-14.6534-20.7127QC'd by "Chem Div"
Inactive04.95490.9526-10.392812.159440 0 0 0 0-10.30087.659413.806714.3816-9.7278-10.3008QC'd by "Chem Div"
Inactive02.25260.9456-15.0824-3.824740 0 0 0 0-14.7061-2.8247-5.6912-3.1226-9.4063-14.7061QC'd by "Chem Div"
Inhibitor12.995378.844742Partial curve; high efficacy-4.88621.55790.9935-82.5518-3.7072-2.10 0 0 0 0-72.8175-6.4603-0.3489-8.7793-32.8366-72.8175QC'd by "Chem Div"
Inhibitor18.356449.742410Single point of activity-4.73622.84730.9797-46.14163.6008-30 0 0 0 0-42.7679-0.89924.9836.9739-2.5062-42.7679QC'd by "Chem Div"
Inactive04.95490.8308-9.79910.472540 0 0 0 0-5.08718.47258.256110.070916.081-5.0871QC'd by "Chem Div"
Inactive01.88510.9722-5.76856.220540 0 0 0 0-5.0636.2205-1.5445-7.1037-5.5678-5.063QC'd by "Chem Div"
Inactive00.30.842-31.92493.17440 0 0 0 0-26.7418-0.826-13.6909-13.1344-14.0869-26.7418QC'd by "Chem Div"
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:TDP1 protein [Homo sapiens]
External ID: TDP1101
Protocol: DT40-hTDP1 cells with 20 nM Camptothecin (add 20 microL of 1 mM CPT stock in 1 L of cell culture medium) were dispensed at 400 cells/5microL/well in tissue culture treated 1536-well white wall/solid bottom assay plates (Greiner Bio-One North America, NC, U.S.A.) using a Multidrop Combi 8 channel dispenser (Thermo Fisher, Waltham, MA, USA). 23 nL compounds and controls were transferred using the pin tool (Kalypsys, San Diego, CA, USA) to the assay plates. The assay plates were then incubated at 37 masculineC for a minimum 48 hr. Three microL of Cell Titer Glo solution was added to the plates and incubated at RT in dark for 30 min. Luminescence was read using ViewLux (Perkin Elmer) with 1 sec exposure slow speed, high gain and 2x binning.
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description". For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.
2. For all inactive compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentActivity_ScoreCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.0000295000 uMActivity at 0.0000590000 uMActivity at 0.0001503265 uMActivity at 0.0002712146 uMActivity at 0.0005895491 uMActivity at 0.00117 uMActivity at 0.00179 uMActivity at 0.00299 uMActivity at 0.00672 uMActivity at 0.014 uMActivity at 0.026 uMActivity at 0.040 uMActivity at 0.074 uMActivity at 0.167 uMActivity at 0.363 uMActivity at 0.628 uMActivity at 0.975 uMActivity at 1.849 uMActivity at 4.119 uMActivity at 9.037 uMActivity at 15.83 uMActivity at 21.08 uMActivity at 46.23 uMActivity at 92.54 uMActivity at 165.6 uMCompound QC
Inhibitor20.5962118.89141Partial curve; high efficacy-4.68622.30310.9994-116.16692.7241-2.10 0 0 0 0-99.94512.72414.25720.7717-13.7373-99.9451QC'd by "Asinex Ltd."
Inactive00.80.9749-16.17712.005740 0 0 0 0-13.14662.00571.2486-2.8352-5.7162-13.1466QC'd by "Asinex Ltd."
Inactive04.95490.6148-11.8012.205940 0 0 0 0-9.7999-4.79413.64526.73633.1419-9.7999QC'd by "Asinex Ltd."
Inactive0-5.03622.33320.9795-28.8852-5.272340 0 0 0 0-28.1997-7.2723-3.3531-4.7215-17.5124-28.1997QC'd by "Asinex Ltd."
Inhibitor5.173594.688584Complete curve; high efficacy-5.28622.90230.9917-96.1842-1.4957-1.10 0 0 0 0-96.0073-7.53084.5779-6.8491-81.1577-96.0073QC'd by "Asinex Ltd."
Inhibitor18.356494.01210Single point of activity-4.73623.62720.9999-96.5346-2.5226-30 0 0 0 0-93.107-2.9055-1.9361-2.363-9.7613-93.107QC'd by "Asinex Ltd."
Inactive04.95490.8434-31.3086-2.25540 0 0 0 0-27.0497-0.755-10.5210.92280.8125-27.0497QC'd by "Asinex Ltd."
Inactive04.44950.7303-25.728-7.249240 0 0 0 0-25.3982-8.7492-13.51280.9177-19.0413-25.3982QC'd by "Asinex Ltd."
Inhibitor20.5962100.541141Partial curve; high efficacy-4.68622.09370.998-104.3872-3.8461-2.10 0 0 0 0-88.9539-4.1551-2.0443-7.1093-18.8654-88.9539QC'd by "Asinex Ltd."
Inhibitor29.092991.413310Single point of activity-4.53624.95490.9947-88.35973.0536-30 0 0 0 0-79.845-1.16852.65594.53855.7131-79.845QC'd by "Asinex Ltd."
Inactive04.95490.786-1.849912.995440 0 0 0 116.19477.995418.22950.5262-1.875716.1947QC'd by "Asinex Ltd."
Inactive04.95490.9259-4.54544.383940 0 0 0 0-3.72395.38394.7472.6664.8335-3.7239QC'd by "Asinex Ltd."
Inactive0-6.23624.95490.9762-1.408619.454340 0 0 0 01.208619.454317.7088-3.3481-2.37561.2086QC'd by "Asinex Ltd."
Inactive04.95490.4363-4.5616-11.561640 0 0 0 0-4.5336-11.5616-1.6565-10.5162-2.2482-4.5336QC'd by "Asinex Ltd."
Inactive00.70.98896.5184-6.981640 0 0 0 02.8921-7.4816-5.7762-3.9537-1.52422.8921QC'd by "Asinex Ltd."
Inactive04.95490.5926-22.1394-0.155940 0 0 0 0-20.8088-4.1559-8.30412.2914-0.0696-20.8088QC'd by "Asinex Ltd."
Inhibitor29.092964.218610Single point of activity-4.53624.95490.9684-70.1227-5.9041-30 0 0 0 0-64.396-9.2052-0.418-11.9994-2.9068-64.396QC'd by "Asinex Ltd."
Inactive01.210.9644-26.92634.843740 0 0 0 0-17.96476.84374.96630.5719-1.9517-17.9647QC'd by "Asinex Ltd."
Inactive04.95490.9261-29.9871.936440 0 0 0 0-26.99980.4364-0.7582-0.45327.9656-26.9998QC'd by "Asinex Ltd."
Inactive04.0950.45761.780312.60740 0 0 0 06.613211.107-4.99860.1865.25796.6132QC'd by "Asinex Ltd."
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Broad Institute 靶标:N/A
External ID: 2134-01_Inhibitor_SinglePoint_HTS_Activity_Set2
Protocol:
1. Clone20-Shn3FFL cells (Lot#1-810) are cultured and expanded in OB media
to obtain sufficient cell numbers to plate across the ~2,100 384-well plates required
to screen in duplicate the 330,000 compounds in the MLSMR collection.
2. Cells are plated at a concentration of 3000 cells per well in 30ul of OB media using a Combi Multidrop (Thermo)
in white opaque 384-well plates (Corning 3570/8867BC).
3. Once plated, cells are incubated overnight at 37 degrees C 5% CO2 95% humidity prior to the addition of
compounds.
4. Compounds are then be added to plates at a volume of 100nl of compound using a steel pin tool (V&P Scientific).
5. Following the addition of compounds, cells will be incubated for an additional 24
hours at 37 degrees C 5%CO2 95% humidity.
6. After 24 hour incubation period, cells and luciferase reagents are allowed to
equilibrate to room temperature for 10 minutes.
7. For firefly luciferase assay, 20ul of Cell Titer Glo luciferase (Promega) is added
to each well with a Combi multidrop and then plates are incubated for 15 minutes at room temperature
on orbital shaker.
8. Plates are read on an Envision multi-mode plate reader (Perkin Elmer) to
obtain luminescence readings (0.1 s/well)
Comment: PRESENCE OF CONTROLS: Neutral control wells (NC) and positive control wells (PC) were included on every plate.

EXPECTED OUTCOME: Active compounds result in decreasing readout signal.

NORMALIZATION:
The raw signals of the plate wells were normalized using the 'Neutral Controls Minus Inhibitors' method in Genedata Assay Analyzer (v7.0.3):
The median raw signal of the intraplate neutral control wells was set to a normalized activity value of 0.
The median raw signal of the intraplate positive control wells was set to a normalized activity value of -100.
Experimental wells values were scaled to this range.
All well activities were then multiplied by -1 to create a positive activity readout value range, to match Pubchem convention.


PATTERN CORRECTION: The plate pattern correction algorithm 'Runwise Pattern (Multiplicative)' in Genedata (v7.0.3) was applied to the normalized plate data.

PUBCHEM_ACTIVITY_SCORE:
This was set as equal to the mean of the normalized and corrected sample replicate activities, rounded to the nearest integer .
The minimum PUBCHEM_ACTIVITY_SCORE required for a compound to be called a hit (the activity threshold, or AT) was set at 75.

PERCENTAGE OF ACTIVE REPLICATES:
For each sample, the percentage of replicates (PCT_ACTIVE_REP) which had activity scores >= AT was determined.
The minimum percentage of replicates required for a compound to be called a hit (PAR_T) was set at 100.

PUBCHEM_ACTIVITY_OUTCOME:
Samples passing BOTH threshold criteria were assigned an outcome of 2 (active):
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP >= PAR_T

Samples passing NEITHER threshold criteria were assigned an outcome of 1 (inactive):
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP < PAR_T

Samples passing AT only were assigned an outcome of 3 (inconclusive) :
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP < PAR_T
REPRODUCIBILITY_COSINE_TRANSFORMPCT_ACTIVE_REPLICATESREPLICATE_A_ACTIVITY_SCORE_12.46uM_(%)REPLICATE_B_ACTIVITY_SCORE_12.46uM_(%)REPLICATE_C_ACTIVITY_SCORE_12.46uM_(%)REPLICATE_D_ACTIVITY_SCORE_12.46uM_(%)
0.11940-2.8983.691
0.7802015.0821.659
0.44250-11.6213.942
0.19870-7.4934.967
0.71230-15.024-0.111
0.89110-14.655-45.073
0.99340-4.697-5.924
0.94040-7.832-16.704
0.9840-13.45-19.396
0.91220-3.865-1.469
0.794206.00845.164
0.08890-3.2863.93
0.42850-4.1911.495
0.999302.2812.116
0.48820-17.6254.98
0.996405.3366.332
0.988807.75610.514
0.9842023.38733.661
0.99690-3.539-3.022
0.95530-11.006-5.805
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Broad Institute 靶标:FATTY-ACID-CoA LIGASE FADD28 (FATTY-ACID-CoA SYNTHETASE)
External ID: 2147-01_Inhibitor_SinglePoint_HTS_Activity
Protocol: Protocol:
The FadD28 is purified through Ni-NTA affinity column due to a 6x Histidine tag. Purified protein is stored at -80 degrees C (D.J. Wilson, and C.C. Aldrich. Anal. Biochem. 404 (2010) 56-63)
I. Solution preparation (For a run of 121 plates):
1) Prepare 700mL of 200nM compound 11 (TAMRA labeled substrate) in FP buffer. Take 1.4mL of 100uM compound 11 in 100% DMSO in 700mL FP buffer
2) Prepare 50mL compound24 (non-labeled substrate) in FP buffer. Take 200uL of 10mM compound 24 in 100% DMSO in 50mL FP buffer
3) Prepare 350mL 4uM FadD28 in FP buffer. Take 1.746mL of 802uM FadD28 in 350mL FP buffer
II. Setup reagents on automation instrument
1) Add the solutions of compound24, FadD28 and FP buffer to the bottles of BioRaptr (Beckman) based on the dispense table
2) Add compound 11 solution to the bottle of combi NL (Thermo Scientific)
3) Add 1536-well assay ready plates (ARPs) to incubator
III. Run automation protocol
1) Dispense 3uL/well of the solutions from BioRaptr based on the dispense table to 1536-well assay ready plates (ARPs) (Aurora, Cat#: 00019180BX)(Positive control wells receive 1.5uL/well of compound24 and 1.5uL/well of FadD28 solution; all the other wells receive 1.5uL/well of FP buffer and 1.5uL/well of FadD28 solution)
2) Incubate the plates for 10mins at 25 degrees C
3) Dispense 3uL/well of 200nM compound11 solution to the plates by Combi NL
4) Incubate the plates for 30mins at 25 degrees C
5) Read the plates on ViewLux (PerkinElmer) with excitation wavelength of 525nm, emission wavelength of 598 nm and dichroic mirror of 550nm
Final concentration: 100nM compound11, 1uM FadD28, 10uM compound24 (positive control), compound concentration for primary screen: 12.5uM
FP buffer: 30mM Tris-HCl, pH7.5, 1mM MgCl2, 1mM DTT, 0.0025% Igepal CA630
Comment: PRESENCE OF CONTROLS: Neutral control wells (NC) and positive control wells (PC) were included on every plate.

EXPECTED OUTCOME: Active compounds result in decreasing readout signal.

NORMALIZATION:
The raw signals of the plate wells were normalized using the 'Neutral Controls Minus Inhibitors' method in Genedata Assay Analyzer (v7.0.3):
The median raw signal of the intraplate neutral control wells was set to a normalized activity value of 0.
The median raw signal of the intraplate positive control wells was set to a normalized activity value of -100.
Experimental wells values were scaled to this range.
All well activities were then multiplied by -1 to create a positive activity readout value range, to match Pubchem convention.


PATTERN CORRECTION: No plate pattern correction algorithm from Genedata Condoseo (v.7.0.3) was applied.

PUBCHEM_ACTIVITY_SCORE:
This was set as equal to the maximum of the normalized sample replicate activities, rounded to the nearest integer .
The minimum PUBCHEM_ACTIVITY_SCORE required for a compound to be called a hit (the activity threshold, or AT) was set at 8.

PERCENTAGE OF ACTIVE REPLICATES:
For each sample, the percentage of replicates (PCT_ACTIVE_REP) which had activity scores >= AT was determined.
The minimum percentage of replicates required for a compound to be called a hit (PAR_T) was set at 100.

PUBCHEM_ACTIVITY_OUTCOME:
Samples passing BOTH threshold criteria were assigned an outcome of 2 (active):
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP >= PAR_T

Samples passing NEITHER threshold criteria were assigned an outcome of 1 (inactive):
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP < PAR_T

Samples passing AT only were assigned an outcome of 3 (inconclusive) :
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP < PAR_T

tSamples passing PAR_T only were assigned an outcome of 3 (inconclusive) :
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP >= PAR_T
REPRODUCIBILITY_COSINE_TRANSFORMPCT_ACTIVE_REPLICATESREPLICATE_A_ACTIVITY_SCORE_12.48uM_(%)REPLICATE_B_ACTIVITY_SCORE_12.48uM_(%)
0.99280-1.516-1.189
0.97280-2.497-1.536
0.99840-3.184-2.848
0.80830-1.604-0.252
0.18770-1.6391.113
0.821400.1120.62
0.99990-2.332-2.278
0.99950-3.841-3.612
0.12190-4.4045.637
0.98970-4.806-3.591
0.99680-8.098-6.898
0.95170-5.151-2.639
0.755600.2343.277
0.6770-0.0340.82
0.987200.9180.663
0.50860-0.4370.112
0.90560-3.302-1.195
0.00970-1.831.795
0.96930-0.764-1.284
0.89760-2.719-0.928
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Broad Institute 靶标:N/A
External ID: Bursicon-induced LGR2 mediated cAMP production in LGR-2/CRE6x-Luciferase co-transfected HEK293 cells Inhibition - 7011-01_Antagonist_SinglePoint_HTS_Activity
Protocol: Protocol

Day 0:
Cell Culture
HEK 293 cells are plated in DMEM culture media (containing 10% Fetal Bovine Serum (FBS) and 1X penn/strep/glutamine) at a density of 5x106 cells/T175 flask and grown for 3 days at 37 degrees C in 5% CO2 incubator.

Day 3:
Transient Transfection
Cells are transiently transfected in DMEM transfection media (containing 1X penn/strep/glutamine without serum) using polyethyleneimine (PEI).
1)Mix 2.9ug/flask of cDNA encoding the wild-type Bursicon Receptor with 14.6ng/flask of cDNA encoding a CRE-luciferase reporter gene with a PEST/HCL sequence in 2mL of transfection media
2)Add 61uL/flask of PEI of 1mg/mL in 1.5mL of transfection media
3)Mix the 2mL cDNA solution with 1.5mL of PEI solution and incubate at RT for 20 mins
4)Aspirated the culture media from the cells in T175 flask
5)Add 25 mL of transfection media and 3.5mL of transfection mixture to T175 falsk.
6)Mix the media with transfection mixture well and transfect for 2 days at 37 degrees C in 5% CO2 incubator

Day 5:
Cell Plating
1)Typsinize the Cells with 5mL of 0.05% Trypsin and incubate at 37oC for 5 min.
2)Add 5mL of DMEM assay media (containing DMEM without phenol red, 10% NuSerum and 1x Pen/Strep/Glutamine) to inactive trypsin
3)Collect cells by centrifugation at 1000rpm for 5 min
4)Suspend the cells in DMEM assay media to a cell density of 4x105 cells/mL
5)Plate the cells to 1536-well Aurora Mako plate with 2000 cells/well/5uL using ViaFill
6)Incubate the cells at 37 degrees C in 5% CO2 incubator on GS system for overnight

Day 6:
Compound Treatment, Agonist Stimulation and Detection
Assay Setup
1)Thaw aliquoted Bursicon conditioned media and diluted with DMEM assay media at a 1/20 dilution. Filter the solution through a 0.22uM filter
2)Add DMEM condition media, the diluted Bursicon conditioned media and SteadyGlo to the bottles and setup BioRAPTR

Run automation protocol on GS system
1)Take the assay plate with transfected cells from the incubator
2)Transfer 5nL/well of 10mM compound to assay plate
3)Incubate 30 mins in incubator
4)Add 1uL/well of DMEM assay media to PosCon wells and diluted Bursicon solution to the other wells using BioRAPTR (Beckman) based on the plate map
5)Incubate the assay plate for 4 h in incubator
6)Take the plate out from the incubator and equilibrate the assay plate at RT for 10 mins
7)Add 1uL/well of SteadyGlo to assay plate using BioRAPTR, incubate at RT for 10 mins
8)Read the plate on ViewLux (PerkinElmer) for Luminescence.

Culture Media
DMEM high glucose, no glutamine (Invitrogen, 11960)
Pen/Strep/Glutamine (Invitrogen 10378-016)
Fetal Bovine Serum (Atlanta Biological, S10350)

Transfection Media
DMEM high glucose, no glutamine (Invitrogen, 11960)
Pen/Strep/Glutamine (Invitrogen 10378-016)

Assay Media
DMEM no phenol red (Invitrogen, 21063-029)
Pen/Strep/Glutamine (Invitrogen 10378-016)
NuSerum (BD biosciences, 24883)

0.05% Trypsin-EDTA (Invitrogen, 25300-062)
Aurora 1536-well Mako plate (Aurora/Brooks, 00028778)
Comment:
REPRODUCIBILITY_COSINE_TRANSFORMPCT_ACTIVE_REPLICATESREPLICATE_A_ACTIVITY_SCORE_9.99uM_(%)
00-208.81
0.99840-216.092
00-162.651
00-162.095
00-158.917
00-156.183
00-151.809
00-151.967
0.99950-161.183
00-147.708
0.99890-146.736
00-141.126
0.99690-165.263
0.99960-146.86
10-137.448
0.9870-136.764
0.9990-135.905
00-134.44
0.99980-139.162
0.99710-155.151
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:ICCB-Longwood/NSRB Screening Facility, Harvard Medical School 靶标:N/A
External ID: HMS1149-MLP
Protocol: A 558 bp region upstream of hspX was PCR amplified and cloned upstream of the GFP-mut2 (Cormack et al., 1996). This construct was cloned into a modified version of the replicating plasmid pSE100 and transformed into CDC1551 to generate CDC1551(hspX'::GFP).

The M. tuberculosis CDC 1551 (hspX'::GFP) fluorescent biosensor was grown in pH 7.0 Middlebrook 7H9 medium to mid- to late-log phase. Black-walled, clear-bottom, tissue-culture treated 384-well microtiter plates (Corning #3712) were filled with 25 uL of buffered pH 7.0 7H9 medium using a Matrix Combi. 100 nL of compound was then transferred to each well via stainless steel pin array. Plates were manually sealed with DMSO-resistant aluminum seals and frozen at -80C until they were ready to be screened. The cultures were re-suspended in pH 7.0 7H9 and 25 uL was dispensed into each well of the 384-well assay plates already containing the perturbator utilizing a Cy-Bio Selma liquid handler robot to an OD595 of 0.05. The plates were then placed in a Ziploc bag with a moistened paper towel (to limit evaporation) and incubated for 6 days at 37C. Fluorescence and optical density (OD) readings were made on an EnSpire plate reader (Perkin Elmer, Inc.) at excitation and emission wavelengths of 488 and 509 nm as a top read, with the OD being taken at 595 nm as a bottom read.

The ~328,633 compound library was arrayed into black-walled, clear-bottom tissue-culture treated 384-well microtiter plates (Corning #3712) by pin transfer (100 nL), containing 25 uL of buffered pH 7.0 7H9 medium. In a previous screen utilizing the same compound library and screening method, four random compound plates were screened in duplicate to observe variation in hit robustness across plates and method. The result was that the duplicate plates did not vary in a statistically significant manner and due to the high volume of compounds to be screened (~328,633), replicates were not utilized.

Negative control: DMSO, 0.1% final concentration in buffered pH 7.0 7H9 in column 2 or column 23 of each plate

Positive control: 0.3 uM Rifampicin final concentration in buffered pH 7.0 7H9 in column 1 or column 24 of each plate
Comment: Analysis methods:
To calculate normalized fluorescence percent inhibition, plate average negative control fluorescence intensity (based on all plates within a screening run) was subtracted from well fluorescence intensity, divided by the difference between plate negative and positive control average fluorescence intensity (based on all plates within a screening run), and multiplied by 100. To calculate normalized growth inhibition, plate average negative control absorbance (based on all plates within a screening run) was subtracted from well absorbance, divided by the difference between plate negative and positive control average absorbance (based on all plates within a screening run), and multiplied by 100. Normalized fluorescence percent inhibition was divided by normalized growth inhibition to calculate a ratio. Wells were considered active if growth was not greatly decreased and showed either a 3-fold selectivity fluorescence to growth inhibition ratio (with 35-45% fluorescence inhibition) or a 1.5-fold selectivity fluorescence to growth inhibition ratio (with > 45% fluorescence inhibition). These compounds may be directly or indirectly inhibiting DosRS signaling. Wells were considered general inhibitors of M. tuberculosis growth if both fluorescence and growth inhibition > 50%. Activity scores were scaled from 100 to 0 and derived from normalized fluorescence percent inhibition, with 100 (or > 100) = 100% inhibition and 0 (or < 0) = no inhibition.
FluorescenceAbsorbanceRatioNormalized Fluorescence InhibitionNormalized Growth InhibitionNormalized FI:GI RatioGeneral Inhibition
361550.2851268608.990745.250731.71228
367210.2811306807.519896.929291.08523
388660.291340211.945723.152540.617191
373140.281332645.978877.348930.81357
359490.2791288499.526077.768571.22623
359210.2871251609.598834.411462.17589
362680.2931237828.697091.893624.59283
392470.321226470.955621-9.43663-0.101267
386200.2861350352.584994.83110.535074
373510.2841315185.882725.670371.03745
380970.2831346183.94416.090010.647635
378520.2951283124.580781.054344.34468
372680.2981250606.09841-0.204574-29.8103
396530.284139623-0.09944285.67037-0.0175373
377440.2931288194.861441.893622.56727
377300.2871314634.897824.411461.11025
391230.3011299771.27786-1.46349-0.873157
366370.2871276557.738184.411461.75411
405660.327124055-2.47204-12.37410.199775
393340.2861375310.7295364.83110.151008
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Broad Institute 靶标:N/A
External ID: 7124-01_Inhibitor_SinglePoint_HTS_Activity
Protocol:
Protocol:
1) Plate 10 uL BL2-NFkB-luc cells at 12.5K cells/well, using a Multidrop Combi reagent dispenser (1,250 cells/uL).
2) Add 25 nL compound or positive control, by pin transfer; IKK inhibitor VII will be used at 50 uM.
3) Incubate at 37 masculineC for 1 hour (allowing compounds to enter cells for action).
4) Add 5 uL 192 ng/mL tCD40L per well for a final concentration of 64 ng/ml using a Thermo Multidrop Combi.
5) Incubate at 37 masculineC for 4 hrs, then leave plate at RT for 30 minutes.
6) Add 15 uL SteadyGlo luciferase substrate (Promega) per well using a Thermo Multidrop Combi.
7) Incubate at RT for 5min, then read Luminescence using LJL Analyst HT plate reader.
Comment: PRESENCE OF CONTROLS: Neutral control wells (NC) and positive control wells (PC) were included on every plate.

EXPECTED OUTCOME: Active compounds result in decreasing readout signal.

NORMALIZATION:
The raw signals of the plate wells were normalized using the 'Neutral Controls Minus Inhibitors' method in Genedata Assay Analyzer (v10.0.2):
The median raw signal of the intraplate neutral control wells was set to a normalized activity value of 0.
The median raw signal of the intraplate positive control wells was set to a normalized activity value of -100.
Experimental wells values were scaled to this range.

PATTERN CORRECTION: No plate pattern correction algorithm from Genedata Condoseo (v.10.0.2) was applied.

PUBCHEM_ACTIVITY_SCORE:
This was set as equal to the mean of the normalized sample replicate activities, rounded to the nearest integer .
The minimum PUBCHEM_ACTIVITY_SCORE required for a compound to be called a hit (the activity threshold, or AT) was set at -50.

PERCENTAGE OF ACTIVE REPLICATES:
For each sample, the percentage of replicates (PCT_ACTIVE_REP) which had activity scores >= AT was determined.
The minimum percentage of replicates required for a compound to be called a hit (PAR_T) was set at 55.

PUBCHEM_ACTIVITY_OUTCOME:
Samples passing BOTH threshold criteria were assigned an outcome of 2 (active):
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP >= PAR_T

Samples passing NEITHER threshold criteria were assigned an outcome of 1 (inactive):
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP < PAR_T

Samples passing AT only were assigned an outcome of 1 (inactive) :
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP < PAR_T

Samples passing PAR_T only were assigned an outcome of 1 (inactive) :
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP >= PAR_T
REPRODUCIBILITY_COSINE_TRANSFORMPCT_ACTIVE_REPLICATESREPLICATE_A_ACTIVITY_SCORE_10uM_(%)REPLICATE_B_ACTIVITY_SCORE_10uM_(%)REPLICATE_C_ACTIVITY_SCORE_10uM_(%)REPLICATE_D_ACTIVITY_SCORE_10uM_(%)REPLICATE_A_ACTIVITY_SCORE_25uM_(%)REPLICATE_B_ACTIVITY_SCORE_25uM_(%)
0.79620-2.349-0.32
105.6735.654
0.992109.2477.171
1010.26510.389
0.99270-11.538-9.04
004.22
0.988401.71.248
0.859020.4545.179
0.572505.367-0.953
0.980-5.16-7.79
0.95509.6865.096
0.68210-13.0050.453
0.875408.3542.409
0.9468011.7385.785
0.98530-15.255-10.751
0.5260-1.7597.464
0.84350102.218
0.9897019.1614.325
10-28.597-28.833
0.993506.7018.436
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:apical membrane antigen 1, AMA1 [Plasmodium falciparum 3D7]
External ID: AMA1100
Protocol: Two microliters of his-tagged AMA1 3D7 allele protein (final concentration 25 nM) was dispensed into a 1,536-well assay plate. Small molecules and positive control peptides were pin-transferred (23 nL or 46 nL) via Kalypsys pin-tool equipped with a 1,536-pin array, resulting in final compound and peptide concentration ranges of 91.5 nM - 57.2 muM, and 15.6 nM - 2.00 muM, respectively. Unlabeled RON2 peptide or R1 peptide (VFAEFLPLFSKFGSRMHILK) that specifically binds the 3D7 AMA1 was used as a positive control that inhibited the binding of RON2L to AMA1. After 15 minutes incubation, 1 uL of biotinylated RON2 peptide (final concentration 25 nM) or buffer were dispensed and the assay plate was incubated for an additional 30 minutes at room temperature and protected from light. This was followed by an addition of 1 uL mixture of donor and acceptor beads (10 ug/mL final concentrations for each). The plates were incubated for 30 min at room temperature and read using the EnVision(R) plate reader (PerkinElmer). Maximum inhibition response was normalized to the positive control signal while no inhibition response was normalized to the DMSO treated wells.
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description". For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.
2. For all inactive compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentActivity_ScoreCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.0003270000 uMActivity at 0.0009544551 uMActivity at 0.00288 uMActivity at 0.00366 uMActivity at 0.00867 uMActivity at 0.021 uMActivity at 0.030 uMActivity at 0.050 uMActivity at 0.094 uMActivity at 0.198 uMActivity at 0.251 uMActivity at 0.464 uMActivity at 0.897 uMActivity at 1.696 uMActivity at 2.322 uMActivity at 4.534 uMActivity at 7.297 uMActivity at 11.61 uMActivity at 22.22 uMActivity at 49.68 uMActivity at 58.24 uMActivity at 116.2 uMActivity at 202.9 uMActivity at 287.0 uMCompound QC
Inactive0-5.454.95490.9995-21.6945-3.795440 0 0 0-21.4769-3.9962-5.4459-21.8288-21.4769QC'd by "Asinex Ltd."
Inactive03.57221241441 0 0 116.162738.571416.397623.929916.1627QC'd by "Asinex Ltd."
Inactive04.95490.8166-5.76510.864640 0 0 0-4.399-0.9461-7.3042-5.8485-4.399QC'd by "Asinex Ltd."
Inactive04.95490.4375.5140 0 0 04.60782.7228.14.16484.6078QC'd by "Asinex Ltd."
Inactive04-3.7445-0.2668-0.8024-2.3835-3.7445QC'd by "Asinex Ltd."
Inactive04.95490.7866-8.1438-1.854640 0 0 1-2.6156-3.3559-0.2955-6.7865-2.6156QC'd by "Asinex Ltd."
Inactive04.95490.9338-11.3197-1.936540 0 0 1-0.7525-3.0486-1.1971-8.1831-0.7525QC'd by "Asinex Ltd."
Inactive04.95490.78796.5-5.148440 0 0 02.9562-3.4579.07547.04232.9562QC'd by "Asinex Ltd."
Inactive04.95490.9133-3.96244.540 0 0 0-2.24453.6677-4.3032-4.9687-2.2445QC'd by "Asinex Ltd."
Inactive01.98870.9998-5.10661440 0 0 16.300713.72557.3637-3.83886.3007QC'd by "Asinex Ltd."
Inactive045.076811.17933.835814.49345.0768QC'd by "Asinex Ltd."
Inactive03.57220.8282-1.91986.540 0 0 0-1.59984.47328.83694.5255-1.5998QC'd by "Asinex Ltd."
Inactive04.95490.8325-2.30529.540 0 0 00.96937.6964-3.308-4.00440.9693QC'd by "Asinex Ltd."
Activator3.981137.72840Single point of activity-5.44.50450.999943.7284630 0 0 121.21646.17468.793743.587221.2164QC'd by "Asinex Ltd."
Inactive04.50450.8329-4.23445.540 0 0 0-1.8623.02116.35366.4558-1.862QC'd by "Asinex Ltd."
Inactive040-1.8127-2.8808-4.73930QC'd by "Asinex Ltd."
Inactive02.40640.9078-20.539-5.663440 0 0 0-15.4491-7.6231-3.8862-5.9113-15.4491QC'd by "Asinex Ltd."
Inactive04.95490.9986-16.7525-3.633141 0 0 0-16.460427.6578-3.4443-12.258-16.4604QC'd by "Asinex Ltd."
Inactive04.95490.9998-10.7679-2.829841 0 0 1-2.411376.2714-2.7748-8.9733-2.4113QC'd by "Asinex Ltd."
Inactive04.95490.9657-4.3794740 0 0 0-4.94775.0336-5.3161-3.2761-4.9477QC'd by "Asinex Ltd."
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:abhydrolase domain-containing protein 4 isoform 1 [Mus musculus]
External ID: ABHD4_INH_FP_1536_1X%INH PRUN
Protocol: Assay Overview:

The purpose of this biochemical assay is to identify compounds that act as inhibitors of alpha/beta hydrolase domain containing 4 (ABHD4). In this assay, ABHD4 protein is incubated with test compounds and fluorophosphonate-rhodamine (FP-Rh) activity-based probe. The reaction is excited with linear polarized light and the intensity of the emitted light is measured as the polarization value (mP). As designed, test compounds that act as ABHD4 inhibitors will prevent ABHD4-probe interactions, thereby increasing the proportion of free (unbound) fluorescent probe in the well, leading to low fluorescence polarization. Compounds are tested in singlicate at a nominal test concentration of 8.92 micromolar.

Protocol Summary:

Prior to the start of the assay, 4 microliters of assay buffer (50 mM HEPES pH 7.0, 150 mM NaCl and 0.01% Pluronic F-127) were dispensed into column 2 only. Next, 4 microliters of assay buffer containing 46.9 ug/mL of ABHD4 mutant protein (S159A) were dispensed into columns 1 and 3 of 1536 microtiter plates and 4 microliters of assay buffer containing 46.9 ug/mL of ABHD4 wild type protein were dispensed into columns 4 thru 48. Then, 45 nL of test compound in DMSO or DMSO alone (0.89% final concentration) were added to the appropriate wells and incubated for 45 minutes at 25 degrees Celsius.

The assay was started by dispensing 1.0 microliter of 188 nM FP-Rh in assay buffer to all wells. Plates were centrifuged and after 60 minutes of incubation at 25 degrees Celsius, fluorescence polarization was read on a Viewlux microplate reader (PerkinElmer, Turku, Finland) using a BODIPY TMR FP filter set and a BODIPY dichroic mirror (excitation = 525nm, emission = 598nm) for 30 seconds for each polarization plane (parallel and perpendicular).

Prior to further calculations, the following formula was used to calculate fluorescence polarization (FP):

FP = ( Raw1 - Raw2 ) / ( Raw1 + Raw2 )

Where:

Raw1 is defined as the S channel.
Raw2 is defined as the P channel.

The percent inhibition for each compound was calculated as follows:

100 *( ( Test_Compound - Median_Low_Control ) / ( Median_High_Control - Median_Low_Control ) )

Where:

Test_Compound is defined as wells containing ABHD4 wild type protein in the presence of test compound and FP-Rh.
High_Control is defined as wells containing ABHD4 mutant protein, DMSO and FP-Rh.
Low_Control is defined as the median of the wells containing test compounds.

PubChem Activity Outcome and Score:


A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Two values were calculated: (1) the average percent inhibition of all compounds tested, and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter, i.e. any compound that exhibited greater % inhibition than the cutoff parameter was declared active.

The reported PubChem Activity Score has been normalized to 100% observed primary inhibition. Negative % inhibition values are reported as activity score zero.

The activity score range for active compounds is 100-6, for inactive 6-0.

List of Reagents:

mABHD4 wild type protein (supplied by Assay Provider)
mABHD4 (S159A) mutant protein (supplied by Assay Provider).
FP-Rh probe (supplied by Assay Provider)
HEPES (Sigma, part 83264)
NaCl (Sigma, part S6546)
Pluronic F-127 (Invitrogen, part P6866)
1536-well plates (Corning, part 7261)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Inhibition at 8.92 uM
10.42
10.41
10.41
10.41
10.41
10.41
10.41
10.41
10.4
10.4
10.4
10.4
10.4
10.4
10.4
10.39
10.39
10.39
10.39
10.38
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Broad Institute 靶标:E-Selectin
External ID: 2152-01_Activator_SinglePoint_HTS_Activity
Protocol: . Coat plates with 0.1% Gelatin in PBS (20ul per well) for 20 minutes at room temp.
Day 0
. Plate 3,000 HUVEC cells/well in 384 well plates, 50l per well, in EGM-2 medium, incubate at 37 degrees Celsius
Day 2
. Pin 100nl of compound, DMSO
. Add 10 ul Positive Control (TNFalpha at 0.3ng/ml)
. Incubate 16h
Day 3
. Aspirate media using plate washer
. Add 70 ul wash buffer using Thermo Multidrop Combi or plate washer (assay provider uses combi)
. Aspirate wash buffer with plate washer
. Add 20 ul blocking antibody (IgG) with combi
. Incubate at room temp for 15 minutes
. Aspirate
. Add 20 ul Biotin conjugated anti-e-selectin antibody with combi
. Incubate 30 minutes at room temp (or 15 minutes at 37 degrees Celsius)
. Aspirate
. Add 70 ul wash buffer using combi or plate washer (assay provider uses combi)
. Aspirate
. Add 20 ul streptavidin-PE using combi or plate washer (assay provider uses combi)
. Incubate 30 minutes at room temp (or 15 minutes at 37 degrees Celsius)
. Aspirate
. Add 70 ul of PBS (not wash buffer)
. Aspirate
. Add 20ul Hoechst/4% PF/PBS mix (fix cells and stain nuclei)
. Incubate 15 minutes at room temp
. Aspirate (PF is a hazardous waste and is collected in a seperate hazardous waste container)
. Add 70ul PBS
. Aspirate
. Add 70 ul PBS
Plates are sealed with foil seal and stored overnight at 4 degrees Celsius prior to imaging

Plates are imaged on an automated microscope (ImageXpress Micro, Molecular Devices Inc.) at 2x magnification using appropriate filter sets for Hoechst and PE fluorescence.

Cell counts and % of cells positive for PE fluorescence are quantified by using a modified Cell Scoring application module in the image analysis software (MetaXpress, Molecular Devices Inc.)
Comment: PRESENCE OF CONTROLS: Neutral control wells (NC) and positive control wells (PC) were included on every plate.

EXPECTED OUTCOME: Active compounds result in increasing readout signal.

NORMALIZATION:
The raw signals of the plate wells were normalized using the 'Stimulators Minus Neutral Controls' method in Genedata Assay Analyzer (v10.0.2):
The median raw signal of the intraplate neutral control wells was set to a normalized activity value of 0.
The median raw signal of the intraplate positive control wells was set to a normalized activity value of 100.
Experimental wells values were scaled to this range.

PATTERN CORRECTION: No plate pattern correction algorithm from Genedata Condoseo (v.10.0.2) was applied.

PUBCHEM_ACTIVITY_SCORE:
This was set as equal to the mean of the normalized sample replicate activities, rounded to the nearest integer .
Compounds decreasing cell viability by more than 20 per cent were eliminated. The minimum PUBCHEM_ACTIVITY_SCORE of E-selectin positive cells required for a compound to be called a hit (the activity threshold, or AT) was set at 10.

PERCENTAGE OF ACTIVE REPLICATES:
For each sample, the percentage of replicates (PCT_ACTIVE_REP) which had activity scores >= AT was determined.
The minimum percentage of replicates required for a compound to be called a hit (PAR_T) was set at 60.

PUBCHEM_ACTIVITY_OUTCOME:
Samples passing BOTH threshold criteria were assigned an outcome of 2 (active):
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP >= PAR_T

Samples passing NEITHER threshold criteria were assigned an outcome of 1 (inactive):
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP < PAR_T

Samples passing AT only were assigned an outcome of 1 (inactive) :
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP < PAR_T

Samples passing PAR_T only were assigned an outcome of 1 (inactive) :
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP >= PAR_T
REPRODUCIBILITY_COSINE_TRANSFORMPCT_ACTIVE_REPLICATESREPLICATE_A_ACTIVITY_SCORE_7.58uM_(%)REPLICATE_B_ACTIVITY_SCORE_7.58uM_(%)
0.6130-0.1850.023
0.99880-0.16-0.145
0.22400.231-0.145
0.719800.0211.166
0.769200.0170.188
0.92620-0.091-0.038
0.955800.4780.903
0.84730-0.338-0.077
0.41360-0.4150.156
0.00680-0.1020.101
0.85060-0.315-0.074
0.6150-0.1971.591
0.62950-0.1661.582
0.90320-0.114-0.04
0.918701.1570.461
0.3570-0.2470.552
0.68970-0.0421.739
0.682600.467-0.016
0.993100.030.024
0.70170-0.0060.811
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:muscarinic acetylcholine receptor M1 [Homo sapiens]
External ID: CHRM1_PAM_FLUO8_1536_1X%ACT PRUN
Protocol: Assay Overview:

The purpose of this assay is to identify compounds that act as positive allosteric modulators (PAMs) and increase activity of the human M1 muscarinic receptor (CHRM1; M1) in cells pre-treated with a known agonist. In this assay, CHO-K1 cells stably expressing human M1 are loaded with the Fluo-8 calcium indicator dye, followed by addition of test compounds and subsequent treatment with the activator acetylcholine at a concentration that results in 20% activation (EC20). As designed, compounds that act as CHRM1 PAMs will increase calcium mobilization, resulting in increased intracellular calcium and relative fluorescence of the indicator dye beyond that of the EC20 of acetylcholine. Compounds are tested in singlicate at a final nominal concentration of 3 micromolar.

Protocol Summary:

The CHO-hM1 cell line was routinely cultured in T-175 sq cm flasks at 37 degrees C and 95% relative humidity (RH). The growth media consisted of Ham's F-12 Nutrient Media (F-12) supplemented with 10% v/v heat-inactivated qualified fetal bovine serum, 20 mM HEPES, 50 micrograms/mL Geneticin, and 1X antibiotic mix (penicillin and streptomycin).

The day before the assay 3000 cells in 3 microliters of growth media were seeded into each well of 1536 well microtiter plates and allowed to incubate at 37 degrees C, 5% CO2, and 95 % RH for 17-24 hours. Next, 2 microliters of the fluorogenic Fluo-8 intracellular calcium indicator mixture (prepared according to the manufacturer's protocol) was added to each well. Plates were then incubated for 1 hour at 37 degrees C, 5% CO2, and 95 % RH, followed by 30 minute incubation at room temperature. Then, 15 nL of test compound in DMSO were transferred to appropriate wells. The assay was started by performing a basal read of plate fluorescence (470-495 nm excitation and 515-575 nm emission) for 5 seconds on the FLIPR Tetra (Molecular Devices) prior to all wells being treated with an EC20 concentration of acetylcholine. Then a real time fluorescence measurement was immediately performed for the remaining 140 seconds of the assay. A ratio for each well was calculated to normalize assay data, according to the following mathematical expression:

Ratio = I_Max / I_Min

Where:

I_Max represents the maximum measured fluorescence emission intensity over the 140 second read and;
I_Min represents the minimum (basal) measured fluorescence emission intensity before compound was added.

The percent activation was calculated from the median ratio as follows:

% Activation = ( ( Ratio_Test_Compound - Median_Ratio_Low_Control ) / ( Median_Ratio_High_Control - Median_Ratio_Low_Control ) ) * 100

Where:

Test_Compound is defined as wells containing test compound.
Low_Control is defined as wells containing Acetylcholine at EC20 and DMSO.
High_Control is defined as wells containing Acetylcholine (EC100) and DMSO.

A mathematical algorithm was used to determine nominally activating compounds in the primary screen. Two values were calculated for each assay plate: (1) the average percent activation of test compound wells and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter on an individual plate basis, i.e. any compound that exhibited greater % activation than the plate based cutoff parameter was declared active.

PubChem Activity Outcome and Score:

The inactive compounds of this assay have an activity score range of 0 to 78 and the active compounds have an activity score range of 50 to 100.

The reported PubChem Activity Score has been normalized to 100% observed primary activation. Negative % activation values are reported as activity score zero.

List of Reagents:

Cell line: Chinese Hamster Ovary (CHO) cells containing hM1 receptor; (Conn Lab)
Calcium sensitive dye: Fluo-8 No Wash Calcium Assay Kit; (AAT Bioquest, part 36316)
Growth media: Ham's F-12; 10% FBS, 20mM HEPES, 50?g/mL G418
Assay media: Ham's F-12, 10% FBS, 20 mM HEPES
Assay plates: Aurora black/clear 1536well FLIPR plate; (Aurora, part 00019326)
Probenecid: 250mM (pH 8.0); (Sigma P8761)
Potentiator: Acetylcholine (50mM stock in water); Sigma A9187
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, and compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Activation at 3 uM
9.75
9.75
9.75
9.75
9.75
9.75
9.75
9.75
9.75
9.75
9.75
9.75
9.75
9.74
9.74
9.74
9.74
9.74
9.74
9.74
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Broad Institute 靶标:N/A
External ID: 2146-01_Inhibitor_SinglePoint_HTS_Activity
Protocol: D54 ERlucT Cell line was obtained from PI in frozen vials.
Thaw vial into T175. Cells are fragile and may take a day or so to acclimate to growth in flask.

Growth Medium:
DMEM, High Glucose, L-Glu 11965-118 Invitrogen
10% FBS , Certified 16000-044 Invitrogen
Pen-Strep (1X)
200 ug/ml G418 10131-027 Invitrogen
Plating Medium:
DMEM, Phenol Red Free, High Glucose 31053-036 Invitrogen (does not contain L-glutamine)
L-Glutamine 1X
10% FBS, Certified 16000-044 Invitrogen
Pen-Strep
NO SELECTION ANTIBIOTIC (G418)

Using automated tissue culture expand T175 flask to triple flask and subsequently scale up to hyper flask (2-3 days between splitting). Estimated 5 hyperflasks needed for one 220 384 well plate run.
Once cells are near confluency seed to 384 well plates.
Seed cells in 384 well white solid bottom plates (Costar 8867BC) at 3,000 cells per well in 30 ul volume in plating medium. (see above: Use phenol red free medium that does not contain selection antibiotic(G418) for seeding cells).
Incubate cells overnight at 37 degrees celsius with 5% CO2.
Pin compounds from compound library to a final concentration of 10 uM in the plate for MLPCN library. Pin positive control (tunicamycin) from sentinel plate to positive control wells for a final concentration of 100 nM.
Incubate cells with compound for a full 24 hours in incubator at 37 degrees celsius with 5% CO2.
Bring plates out of incubator to deck to equilibrate to room tempurature (20 minutes) .
Add 20 ul of Bright-Glo (Promega) reagent (luciferin+ ATP) per well.
Incubate 10 minutes at room temperature.
Read on Envision plate reader using standard luminescence setting , 0.1 sec read per well.
Comment: PRESENCE OF CONTROLS: Neutral control wells (NC) and positive control wells (PC) were included on every plate.

EXPECTED OUTCOME: Active compounds result in increasing readout signal.

NORMALIZATION:
The raw signals of the plate wells were normalized using the 'Stimulators Minus Neutral Controls' method in Genedata Assay Analyzer (v7.0.3):
The median raw signal of the intraplate neutral control wells was set to a normalized activity value of 0.
The median raw signal of the intraplate positive control wells was set to a normalized activity value of 100.
Experimental wells values were scaled to this range.

PATTERN CORRECTION: The plate pattern correction algorithm 'Runwise Pattern (Multiplicative)' in Genedata (v7.0.3) was applied to the normalized plate data.

PUBCHEM_ACTIVITY_SCORE:
This was set as equal to the mean of the normalized and corrected sample replicate activities, rounded to the nearest integer .
The minimum PUBCHEM_ACTIVITY_SCORE required for a compound to be called a hit (the activity threshold, or AT) was set at 25.

PERCENTAGE OF ACTIVE REPLICATES:
For each sample, the percentage of replicates (PCT_ACTIVE_REP) which had activity scores >= AT was determined.
The minimum percentage of replicates required for a compound to be called a hit (PAR_T) was set at 100.

PUBCHEM_ACTIVITY_OUTCOME:
Samples passing BOTH threshold criteria were assigned an outcome of 2 (active):
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP >= PAR_T

Samples passing NEITHER threshold criteria were assigned an outcome of 1 (inactive):
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP < PAR_T

Samples passing AT only were assigned an outcome of 3 (inconclusive) :
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP < PAR_T
REPRODUCIBILITY_COSINE_TRANSFORMPCT_ACTIVE_REPLICATESREPLICATE_A_ACTIVITY_SCORE_12.46uM_(%)REPLICATE_B_ACTIVITY_SCORE_12.46uM_(%)
0.67620-0.0250.584
0.837401.6330.343
0.155201.259-0.917
0.713100.0283.25
0.282701.142-2.096
0.983200.6380.928
0.14970-2.4431.8
0.68520-1.1520.035
0.699300.563-0.006
0.78160-0.246-2.192
00-0.218
00-2.046
0.96180-2.638-4.737
0.88270-1.903-6.233
0.679300.113-2.914
0.74140-1.151-0.057
0.9960-3.816-4.565
0.841800.6072.774
0.016701.971-1.907
0.99590-3.158-2.634
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Broad Institute 靶标:N/A
External ID: 2132-01_Agonist_SinglePoint_HTS_Activity
Protocol:
Vibrio cholerae quorum-sensing modulator bioassay
Reporter strain:
1.BH1578 (V. cholerae AcqsA AluxQ carrying pBB1 cosmid, which contains the V. harveyi luxCDABE luciferase operon)
Materials:
LB Medium: Dissolve in 10 g/L Tryptone, 5 g/L Yeast Extract, and 10 g/L NaCl in distilled water, autoclave, store at room temperature
Tetracycline (10 mg/mL): Dissolve 10 mg tetracycline in 1 mL 100% ethanol, store at -20 degrees C, protect from light
LB/tet: add 1 mL tetracycline (10 mg/mL) to 1L of LB medium. Final concentration of tetracycline is 10 microg/mL. Prepare it fresh on a daily basis.
CAI-1 stock: Dissolve CAI-1 in DMSO to 50 mM (10.7 mg/mL), store at -20 degrees C
Procedures:
1.Grow up the BH1578 reporter strain in 100 mL LB/Tet at 30 oC for >16 hours with shaking (200 rpm). The final OD600 of each culture should be > 3.0
2.Dilute the culture to an OD600 of 0.9 with LB/Tet, mix well. (Note: avoid biofilm aggregates in the culture, a low speed centrifugation (200 rpm for 1 min) should remove most aggregates)
3.Add 20 uL of LB-Tet per 384 well assay plate with the Thermo Combi fluid dispenser. Add 150 nL of compound per well.
4.Dispense 10 microL of diluted culture into each well of a 384 well plate (Black with clear bottom Greiner 781096 plates). Compounds are screened at 20 microM final concentration. 1 uM CAI-1 was used as the positive control.
5.Incubate the plates at 30 degrees C for 6 hours.
5.Measure bioluminescence (USLum(384)) and OD600 in a Perkin-Elmer Envison Multilabel Reader
Comment: PRESENCE OF CONTROLS: Neutral control wells (NC) and positive control wells (PC) were included on every plate.

EXPECTED OUTCOME: Active compounds result in increasing readout signal.
NORMALIZATION:
The raw signals of the plate wells were normalized using the 'Stimulators Minus Neutral Controls' method in Genedata Assay Analyzer (v7.0.3):
The median raw signal of the intraplate neutral control wells was set to a normalized activity value of 0.
The median raw signal of the intraplate positive control wells was set to a normalized activity value of 100.
Experimental wells values were scaled to this range.
PATTERN CORRECTION: No plate pattern correction algorithm from Genedata Condoseo (v.7.0.3) was applied.

PUBCHEM_ACTIVITY_SCORE:
This was set as equal to the mean of the normalized sample replicate activities, rounded to the nearest integer .
The minimum PUBCHEM_ACTIVITY_SCORE required for a compound to be called a hit (the activity threshold, or AT) was set at 30.

PERCENTAGE OF ACTIVE REPLICATES:
For each sample, the percentage of replicates (PCT_ACTIVE_REP) which had activity scores >= AT was determined.
The minimum percentage of replicates required for a compound to be called a hit (PAR_T) was set at 50.

PUBCHEM_ACTIVITY_OUTCOME:
Samples passing BOTH threshold criteria were assigned an outcome of 2 (active):
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP >= PAR_T

Samples passing NEITHER threshold criteria were assigned an outcome of 1 (inactive):
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP < PAR_T

Samples passing AT only were assigned an outcome of 3 (inconclusive) :
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP < PAR_T

tSamples passing PAR_T only were assigned an outcome of 2 (active) :
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP >= PAR_T

NOTE: Raw signal values for inactive compounds were outside the linear detection range of the plate reader; therefore, no REPRODUCIBILITY_COSINE_TRANSFORM was calculated for inactive compounds.
REPRODUCIBILITY_COSINE_TRANSFORMPCT_ACTIVE_REPLICATESREPLICATE_A_ACTIVITY_SCORE_18.7uM_(%)REPLICATE_B_ACTIVITY_SCORE_18.7uM_(%)REPLICATE_C_ACTIVITY_SCORE_18.7uM_(%)REPLICATE_D_ACTIVITY_SCORE_18.7uM_(%)
000
000
000
0-6.250
000
06.250
000
0-7.143-7.692
00-7.692
000
00-25
0-11.7650
011.765-25
000
005.714
000
000
000
00-5.714
07.1430
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:RecName: Full=Sialate O-acetylesterase; AltName: Full=H-Lse; AltName: Full=Sialic acid-specific 9-O-acetylesterase; Flags: Precursor [Homo sapiens]
External ID: SIAE_INH_FP_1536_1X%INH PRUN
Protocol: Assay Overview:

The purpose of this biochemical assay is to identify compounds that act as inhibitors of sialic acid acetylesterase (SIAE). In this assay, SIAE protein is incubated with test compounds and fluorophosphonate-rhodamine (FP-Rh) activity-based probe. The reaction is excited with linear polarized light and the intensity of the emitted light is measured as the polarization value (mP). As designed, test compounds that act as SIAE inhibitors will prevent SIAE-probe interactions, thereby increasing the proportion of free (unbound) fluorescent probe in the well, leading to low fluorescence polarization. Compounds are tested in singlicate at a nominal test concentration of 9.66 micromolar.

Protocol Summary:

Prior to the start of the assay, 3 microliters of assay buffer (1X DPBS and 0.01% Pluronic F-127) were dispensed into column 1 thru column 3 of 1536 microtiter plates. Next, 3 microliters of assay buffer containing 0.73uM of SIAE protein were dispensed into columns 4 thru 48. Then, 39 nL of test compound in DMSO or DMSO alone (0.97% final concentration) were added to the appropriate wells and incubated for 45 minutes at 25 degrees Celsius.

The assay was started by dispensing 1.0 microliter of 300 nM FP-Rh in assay buffer to all wells. Plates were centrifuged and after 120 minutes of incubation at 25 degrees Celsius, fluorescence polarization was read on a Viewlux microplate reader (PerkinElmer, Turku, Finland) using a BODIPY TMR FP filter set and a BODIPY dichroic mirror (excitation = 525nm, emission = 598nm) for 25 seconds for each polarization plane (parallel and perpendicular).

Prior to further calculations, the following formula was used to calculate fluorescence polarization (FP):

FP = ( Raw1 - Raw2 ) / ( Raw1 + Raw2 )

Where:

Raw1 is defined as the S channel.
Raw2 is defined as the P channel.

The percent inhibition for each compound was calculated as follows:

100 *( ( Test_Compound - Median_Low_Control ) / ( Median_High_Control - Median_Low_Control ) )

Where:

Test_Compound is defined as wells containing SIAE protein in the presence of test compound and FP-Rh.
High_Control is defined as wells containing DMSO, FP-Rh but, no SIAE protein.
Low_Control is defined as the median of the wells containing test compounds.

PubChem Activity Outcome and Score:

A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Four values were calculated: (1) the average percent inhibition of all high controls tested plus three times the standard deviation of the high controls, (2) the average percent inhibition of all low controls tested minus three times the standard deviation of the low controls, (3) the average percent inhibition of all compounds tested between (1) and (2), and (4) three times their standard deviation. The sum of two of these values, (3) and (4), was used as a cutoff parameter, i.e. any compound that exhibited greater % inhibition/activity than the cutoff parameter was declared active.

The reported PubChem Activity Score has been normalized to 100% observed primary inhibition. Negative % inhibition values are reported as activity score zero.

The activity score range for active compounds is 100-2, for inactive 2-0.

List of Reagents:

SIAE protein (supplied by Assay Provider)
FP-Rh probe (supplied by Assay Provider)
DPBS (Mediatech, part 20-031-CV)
Pluronic F-127 (Invitrogen, part P6866)
1536-well plates (Greiner, part 789176)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Inhibition at 9.66 uM
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
6.91
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Broad Institute 靶标:Caspase 6, apoptosis related cysteine peptidase
External ID: 7052-01_Inhibitor_SinglePoint_HTS_Activity_Set2
Protocol: Caspase 6 enzyme was received from collaborator and stored at -80 C. Stock concentration was at 1.2 mg/ml (43.1 uM).

Assay Buffer:
100 mM Hepes pH 7.5, 10% sucrose, 0.1 % CHAPS, 5 mM DTT (final concentration) was added fresh just prior to assay

Reagents:
VEID-R110-VEID: Caspase 6 substrate, was reconstituted to 10 mM from dry powder with DMSO and stored at -20 C.
VEID-CHO: Caspase inhibitor (positive control) was reconstituted to 10 mM from dry powder with DMSO and stored at -20 C.

Assay Ready Plates:
1536 black, solid bottom plates containing 7.5 ul of compound

Protocol:
Add 4 ul 2.2 nM Caspase-6 to 1536 ARPS using BioRaptR
Add 100 nL VEID-CHO to positive control wells using Combi nL
Incubate Room temp 60 min
Add 2 ul of 24 uM VEID-R110-VEID (Caspase 6 substrate) to all wells
Incubate at room temp for 40 min
Read plate on Envision (FITC settings and filters)
Comment: PRESENCE OF CONTROLS: Neutral control wells (NC) and positive control wells (PC) were included on every plate.

EXPECTED OUTCOME: Active compounds result in decreasing readout signal.

NORMALIZATION:
The raw signals of the plate wells were normalized using the 'Neutral Controls' method in Genedata Assay Analyzer (v10.0.2):
The median raw signal of the intraplate neutral controls (NC) is set to a normalized activity value of 0.
A normalized activity value of 100 is defined as (2)(NC).
A normalized activity value of -50 is defined as (0.5)(NC).
Experimental wells values were scaled to this range.
All well activities were then multiplied by -1 to create a positive activity readout value range, to match Pubchem convention.


PATTERN CORRECTION: The plate pattern correction algorithm 'Runwise Pattern (Multiplicative)' in Genedata (v10.0.2) was applied to the normalized plate data.

PUBCHEM_ACTIVITY_SCORE:
This was set as equal to the mean of the normalized and corrected sample replicate activities, rounded to the nearest integer .
The minimum PUBCHEM_ACTIVITY_SCORE required for a compound to be called a hit (the activity threshold, or AT) was set at 35.

PERCENTAGE OF ACTIVE REPLICATES:
For each sample, the percentage of replicates (PCT_ACTIVE_REP) which had activity scores >= AT was determined.
The minimum percentage of replicates required for a compound to be called a hit (PAR_T) was set at 100.

PUBCHEM_ACTIVITY_OUTCOME:
Samples passing BOTH threshold criteria were assigned an outcome of 2 (active):
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP >= PAR_T

Samples passing NEITHER threshold criteria were assigned an outcome of 1 (inactive):
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP < PAR_T

Samples passing AT only were assigned an outcome of 3 (inconclusive) :
PUBCHEM_ACTIVITY_SCORE >= AT, and PCT_ACTIVE_REP < PAR_T

Samples passing PAR_T only were assigned an outcome of 3 (inconclusive) :
PUBCHEM_ACTIVITY_SCORE < AT, and PCT_ACTIVE_REP >= PAR_T
REPRODUCIBILITY_COSINE_TRANSFORMPCT_ACTIVE_REPLICATESREPLICATE_A_ACTIVITY_SCORE_12.48uM_(%)
00-6.052
00-6.27
00-6.306
00-6.039
00-6.269
00-6.681
00-6.107
00-6.772
00-6.297
00-6.301
00-6.929
00-6.036
00-6.046
00-6.202
00-6.513
00-6.312
00-6.488
00-6.404
00-6.918
00-6.65
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:thioredoxin reductase [Rattus norvegicus]
External ID: TRXR101
Protocol: Assay protocol: 2 uL of reagents (buffer in column 4 as negative control and 90 nM rTrxR1 in columns 1-3 and 5-48) were dispensed into Greiner black solid-bottom 1,536-well assay plates, followed by 1 uL of NADPH (400 uM final concentration) to each well. The plates were centrifuged at 1000 rpm for 15 seconds and subsequently incubated for 5 min at room temperature (~22 deg C) to allow for rTrxR1 reduction. Compounds (23 nL) were then transferred via Kalypsys pin tool equipped with 1536-pin array (10 nL slotted pins, V&P Scientific, San Diego, CA). In addition, a duplicate 2-fold serial dilution of the control compounds auranofin, a known gold-based TrxR1 inhibitor, and juglone (5-hydroxy-1,4-naphthoquinone), a natural TrxR1 substrate, were pin-transferred to columns 2 and 3, respectively. After incubation for 15 min at room temperature (~22 deg C), 1 uL of selenite (400 uM final concentration) were dispensed to each well. The plate was immediately transferred to a ViewLux high-throughput CCD imager (PerkinElmer), wherein kinetic measurements of NADPH fluorescence (Ex 340 nm, Em 450 nm) were acquired (8 minute kinetic read, see Table 1). Read 1 was utilized to assess the capacity of a compound to serve as an rTrxR1 substrate, i.e. a decrease in NADPH fluorescence compared to the no-compound background is an indication of a substrate behavior for that particular compound. For inhibitory activity of a compound, delta values, computed as the difference in fluorescence intensity between the first and last reads of an 8-minute time kinetic window, were used. All reagents were diluted in an assay buffer consisting of 50 mM Tris-HCl, pH 7.5, 2 mM EDTA, and 0.01% Tween-20.

Throughout the screen, reagent bottle and all liquid lines were made light-tight to minimize reagent degradation. All screening operations were performed on a fully integrated robotic system (Kalypsys, San Diego, CA) containing one RX-130 and two RX-90 anthropomorphic robotic arms (Staubli, Duncan, SC). Library plates were screened starting from the lowest and proceeding to the highest concentration, and a 'double-pinning' step of the highest concentration was required to access higher concentrations of compounds. Vehicle-only plates, with DMSO being pin-transferred to the columns 5-48, were inserted uniformly at the beginning and the end of each library in order to monitor and record any shifts in the background, which can be affected by reagent dispensers or loss in enzyme activity over time. Screening data were corrected, normalized, and concentration-effect relationships were derived by using publicly-available curve fitting algorithms developed in-house (http://ncgc.nih.gov/pub/openhts).
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description". For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.
2. For all inactive compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.00366 uMActivity at 0.018 uMActivity at 0.023 uMActivity at 0.046 uMActivity at 0.073 uMActivity at 0.091 uMActivity at 0.165 uMActivity at 0.229 uMActivity at 0.457 uMActivity at 0.575 uMActivity at 0.940 uMActivity at 1.600 uMActivity at 2.289 uMActivity at 3.140 uMActivity at 4.699 uMActivity at 9.139 uMActivity at 11.40 uMActivity at 21.25 uMActivity at 28.60 uMActivity at 57.07 uMActivity at 80.69 uMActivity at 114.0 uMActivity at 162.0 uMActivity at 229.0 uMCompound QC
Inactive45.72148.631410.15099.45326.79415.7214QC'd by "Asinex Ltd."
Inactive44.61124.6112QC'd by "Asinex Ltd."
Inactive4-2.3744-2.3744QC'd by "Asinex Ltd."
Inactive40 0 0 0 0 06.7367-4.00622.24971.42662.00113.38086.7367QC'd by "Asinex Ltd."
Inactive4-2.7854-1.3593-1.6912-2.00741.8167-0.4278-2.7854QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-2.73882.76910.2194.5423.4083-2.7388QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-0.01174.05790.94471.1341-2.3162-0.0117QC'd by "Asinex Ltd."
Inactive40 0 0 0 03.769511.71047.43534.05683.10083.7695QC'd by "Asinex Ltd."
Inactive45.54985.90443.24915.2766.93335.5498QC'd by "Asinex Ltd."
Inactive412.084312.909110.11912.577412.251512.0843QC'd by "Asinex Ltd."
Inactive4-0.26292.95251.14641.45140.2181-0.2629QC'd by "Asinex Ltd."
Inactive48.32116.29417.2894.28013.18948.3211QC'd by "Asinex Ltd."
Inactive4-3.1455-0.84532.5993-2.2393-0.3052-3.1455QC'd by "Asinex Ltd."
Inactive40 0 0 0 13.78677.87045.31354.3995-2.74563.7867QC'd by "Asinex Ltd."
Inactive40 0 0 0 0 1-8.8426-4.2899-7.4803-5.849-5.1242-0.9961-8.8426QC'd by "Asinex Ltd."
Inactive43.17043.75230.21974.2066-1.76832.17843.1704QC'd by "Asinex Ltd."
Inactive411.644911.6449QC'd by "Asinex Ltd."
Inactive4-0.87222.8697-0.0842-0.97930.7832-1.5591-0.8722QC'd by "Asinex Ltd."
Inactive40 0 0 0 0 0-15.52351.87083.8960.84580.9194-4.7588-15.5235QC'd by "Asinex Ltd."
Inactive40 0 0 0 06.80262.85661.8310.9212-2.5846.8026QC'd by "Asinex Ltd."
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:DNA (cytosine-5)-methyltransferase 1 isoform b [Homo sapiens]
External ID: SBCCG-A699-DNMT1-Inh-Primary-Assay
Protocol: Assay materials:
1) DNMT1 methyltransferase (catalytic domain 520-1632aa) was obtained from the Dr. Jim Stivers laboratory.
2) 23-mer DNA oligo, methylated and labeled with fluorescein, 5'-FAM-GAG AAG -iMe-dC-GC AGT GGG TGG ATC CAG -3', and 24-mer DNA oligo, conjugated to the dabcyl quencher, 5'- CTG GAT CCA CCC ACT GCG GTT CTC -Dab-3', were custom synthesized by Integrated DNA Technologies
3) Hinp1I restriction endonuclease (Cat # 303-0125) and S-adenosylmethionine (Cat # B9003S) were purchased from New England Biolabs
4) Assay Buffer: 100 mM Tris-HCl pH 8.0 , 2 mM EDTA , 1 mM DTT, 0.004% BRIJ35, 10% Glycerol
5) Stop Solution: 100 mM Potassium Chloride, 11 mM Magnesium Chloride
6) Corning 1536 well black plate (Cat # 3724)

uHTS Procedure

1) Using LabCyte Echo, transfer 37.5 nL of test compounds from a 2 mM compound source plate into assay plate Cols. 5-48 (final concentration of test compounds is 10 uM, 0.5 % DMSO). Transfer 37.5 nL of 100% DMSO into assay plate Col. 1-4.
2) Spin plates at 1500 rpm for 1 minute on Eppendorf centrifuge 5810.
3) Using Thermo Scientific MultiDrop Combi, dispense 2 uL of Assay Buffer into columns 1-2, dispense 2 uL of 30 nM DNMT1 solution in Assay Buffer into columns 3-48.
4) Using Thermo Scientific MultiDrop Combi nL, dispense 2 uL of SAM/DNA Mix, containing 3 uM S-adenosylmethionine and 250 nM duplex DNA oligo in Assay Buffer, into columns 1-48.
5) Spin plates at 1500 rpm for 1 minute on Eppendorf centrifuge 5810.
6) Incubate for 120 minutes at room temp.
7) Using Thermo Scientific MultiDrop Combi nL, dispense 1.5 uL of Stop Solution into columns 1-48.
8) Using Thermo Scientific MultiDrop Combi nL, dispense 2 uL of 1u/uL Hinp1I into columns 1-48.
9) Spin plates at 1500 rpm for 1 minute on Eppendorf centrifuge 5810.
10) Seal the plates and incubate for 16 hours at 37 degrees C
11) Spin plates at 1500 rpm for 1 minute on Eppendorf centrifuge 5810.
12) Read plates on Perkin Elmer Envision at Ex/Em 485/520 nM in fluorescence intensity mode
Comment: Compounds that demonstrated an activation of >= 50% at 10uM concentration are defined as actives in this assay.

The experimental values were normalized by the difference between values from neutral and stimulator control wells in each plate. Then normalized data was corrected to remove systematic plate patterns due to artifacts such as dispensing tip issues etc. Further information about data correction is available at http://www.genedata.com/products/screener.html.

To simplify the distinction between the inactives of the primary screen and of the confirmatory screening stage, the Tiered Activity Scoring System was developed and implemented.

Activity Scoring
Activity scoring rules were devised to take into consideration compound efficacy, its potential interference with the assay and the screening stage that the data was obtained. Details of the Scoring System will be published elsewhere. Briefly, the outline of the scoring system utilized for the assay is as follows:
1) First tier (0-40 range) is reserved for primary screening data. The score is correlated with % activity in the assay:
a. If outcome of the primary screen is inactive, then the assigned score is 0
b. If outcome of the primary screen is inconclusive, then the assigned score is 10
c. If outcome of the primary screen is active, then the assigned score is 20
Scoring for Single concentration confirmation screening is not applicable to this assay.
d. If outcome of the single-concentration confirmation screen is inactive, then the assigned score is 21
e. If outcome of the single-concentration confirmation screen is inconclusive, then the assigned score is 25
f. If outcome of the single-concentration confirmation screen is active, then the assigned score is 30
This scoring system helps track the stage of the testing of a particular SID. For the primary hits which are available for confirmation, their scores will be greater than 20. For those which are not further confirmed, their score will stay under 21.

2) Second tier (41-80 range) is reserved for dose-response confirmation data and is not applicable in this assay

3) Third tier (81-100 range) is reserved for resynthesized true positives and their analogues and is not applicable in this assay
%Activation at 10 uM ValueMean HighSTD Deviation HighMean LowSTD Deviation Low
-0.4221400002094062.595530.583527580.65131419.56
6.3822900002094062.595530.583527580.65131419.56
3.4222000002094062.595530.583527580.65131419.56
1.0921500002094062.595530.583527580.65131419.56
5.4722400002094062.595530.583527580.65131419.56
-0.3121600002094062.595530.583527580.65131419.56
5.4722400002094062.595530.583527580.65131419.56
1.1621500002094062.595530.583527580.65131419.56
1.9721600002094062.595530.583527580.65131419.56
-1.9221300002094062.595530.583527580.65131419.56
-6.321300002094062.595530.583527580.65131419.56
1.8721000002094062.595530.583527580.65131419.56
0.7521300002094062.595530.583527580.65131419.56
-0.521100002094062.595530.583527580.65131419.56
0.5320400002094062.595530.583527580.65131419.56
0.2720400002094062.595530.583527580.65131419.56
-3.0320300002094062.595530.583527580.65131419.56
-0.3120600002094062.595530.583527580.65131419.56
-1.3420500002094062.595530.583527580.65131419.56
-2.5520500002094062.595530.583527580.65131419.56
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:N/A
External ID: SBCCG-A1015-NR3A-Primary-Assay
Protocol: A.#Brief Description of the Assay
This assay attempts to identify small molecule compound binding to NR3A LBD using differential scanning fluorimetry assay. The assay is performed format using Applied Biosystems 384-well plates (cat #4309849) on ViiA7 qPCR instrument (Thermo-Fisher Scientific).

B.#Assay reagent components:
1.#Assay buffer: 20 mM HEPES, pH 7.5, 200 mM NaCl
2.#NR3A LBD working solution in the assay buffer
3.#NR3A LBD with glycine working solution in the assay buffer
4.#Sypro Orange working solution in the assay buffer
5.#Compounds in 100% DMSO

C.#Step-by-step protocol:
1.#Reagent dispenses
a.#Add compound aliquots to the wells in columns 3-24
b.#Add DMSO aliquots to the wells in columns 1-2
c.#Dispense 5 uL of NR3A LBD working solution into columns 2-24
d.#Dispense 5 uL of NR3A LBD with glycine working solution to column 1
e.#Dispense 5 uL of Sypro Orange with glycine solution to columns 1-24
2.#Perform assay by ramping temperature and measuring concomitant changes in fluorescence
3.#Determine Tm corresponding to the maximum of the first derivative of fluorescence
D.#Final concentration of reagents in the assay wells
1.#1.25 uM NR3A LBD (all wells)
2.#x5 Sypro Orange (all wells)
3.#25 uM tested compounds (wells in columns 3-24)
4.#0.25% DMSO (all wells)
E.#Plate Map:
1.#Positive (high Tm) control in column 1
2.#Negative (low Tm) control in column 2.
3.#Test wells in columns 3-24.
Comment: %Activity = (Melting temperature of compound well - Average melting temperature of negative control well)/(Melting temperature of positive control wells - Melting temperature of negative control wells)*100%.

Compounds that demonstrated %Activity >= 10% at 25 uM concentration are defined as actives in this assay.

Activity Scoring
The score is correlated with % activity in the assay:
a. If outcome of the primary screen is inactive, then the assigned score is 0
b. If outcome of the primary screen is active, then the assigned score is 20
%Activity at 25 uMValue at 25uMMean HighSTD Deviation HighMean LowSTD Deviation Low
-0.2639.35949.230.6839.390.67
3.9839.77749.230.6839.390.67
-0.2639.35949.230.6839.390.67
1.1539.49849.230.6839.390.67
3.9839.77749.230.6839.390.67
2.5639.63749.230.6839.390.67
6.840.05549.230.6839.390.67
5.3939.91649.230.6839.390.67
5.3939.91649.230.6839.390.67
1.1539.49849.230.6839.390.67
1.1539.49849.230.6839.390.67
-0.2639.35949.230.6839.390.67
-1.6839.2249.230.6839.390.67
2.5639.63749.230.6839.390.67
5.3939.91649.230.6839.390.67
2.5639.63749.230.6839.390.67
3.9839.77749.230.6839.390.67
-1.6839.2249.230.6839.390.67
2.5639.63749.230.6839.390.67
2.5639.63749.230.6839.390.67
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:E3 ubiquitin-protein ligase UHRF1 isoform 1 [Homo sapiens]
External ID: UHRF1-CPGDNA_INH_TRFRET_1536_1X%INH CSRUN for MBD2-CPGDNA INH
Protocol: Assay Overview:

The purpose of this assay is to determine whether compounds identified as inhibitors of MBD2 are nonselective, as determined by inhibition of methylated DNA-binding activity of the SRA domain polypeptide of ubiquitin-like with PHD and ring finger domains 1 (UHRF1). The UHRF1 gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. It contains a Set-and RING Associated (SRA) domain that binds to partially methylated DNA sequences during DNA synthesis. UHRF1 exhibits a different mode of DNA binding than MBD2, binding so-called hemi-methylated cytosines in order to promote their fully methylation. This assay is performed in a similar manner as the MBD2 screen, except that it employs recombinant UHRF1 SRA domain protein (UHRF1_SRA) and hemi-methylated DNA as its substrate. This assay monitors the ability of compounds to inhibit binding of cloned recombinant UHRF1_SRA to a FAM-labeled 14 bp hairpin oligonucleotide containing a hemimethylated CpG. In this biochemical assay, test compounds are incubated with UHRF1_SRA and a 5-carboxyfluorescene (FAM)-labeled 14bp hairpin DNA oligonucleotide containing one hemimethylated CpG dinucleotide in the presence of Tb-labeled anti-His antibody. An inhibitor of the UHRF1_SRA:FAM hemimethylated CpG interaction will inhibit binding between UHRF1 and FAM hemimethylated oligo, leading to reduced energy transfer and reduced well FRET (fluorescein emission / Tb emission). Compounds are tested in singlicate at a final nominal concentration of 4.4 micromolar.

Protocol Summary:

The assay was started by dispensing 5 microliters of Control Mix in assay buffer (4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 125 mM NaCl, 10 mM Tris-HCl (pH 7.4), and 0.2% Tween-20) containing 125 nanomolar of UHRF1 protein, 5 micromolar of FAM labeled methylated CpG DNA oligo and 5 nanomolar of Terbium labeled anti-his antibody into columns 1 thru columns 2 of 1536 microtiter plates. Next, 5 microliters of Experimental Mix containing 125 nanomolar of UHRF1 protein, 100 nanomolar FAM labeled Hemimethylated CpG DNA oligo and 5 nanomolar Terbium labeled anti-his antibody in assay buffer were dispensed into columns 3 thru 48. Then, the plates were centrifuged and pinned with 22 nL of test compound in DMSO, Mitoxantrone (1.3 micromolar final concentration) in DMSO or DMSO alone (0.44% final concentration). The plates were incubated for 60 minutes at 25 degrees Celsius and TR-FRET was measured on a Viewlux microplate reader (Perkin Elmer, Turku, Finland). After excitation at 340 nm, well fluorescence was monitored at 495 nm (Tb) and 525 nm (FAM). For each well, a fluorescence ratio was calculated according to the following mathematical expression:
Ratio = I525nm / I495nm

Where:

I525nm represents the measured fluorescence emission at 525 nm.
I495nm represents the measured fluorescence emission at 495 nm.

The percent inhibition for each compound was calculated using as follows:

%_Inhibition = 100 * ( Ratio_Test_Compound - Median_Ratio_Low_Control ) / ( Median_Ratio_High_Control - Median_Ratio_Low_Control ) )

Where:

Test_Compound is defined as wells containing the Experimental Mix in the presence of test compound.
High_Control is defined as wells containing the Experimental Mix, Mitoxantrone and DMSO.
Low_Control is defined as the median of the wells containing test compounds.

PubChem Activity Outcome and Score:

A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Two values were calculated: (1) the average percent inhibition of all compounds tested, and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter, i.e. any compound that exhibited greater % inhibition than the cutoff parameter was declared active.

The reported Pubchem Activity Score has been normalized to 100% observed primary inhibition. Negative % inhibition values are reported as activity score zero.

The PubChem Activity Score range for active compounds is 100-19, and for inactive compounds 19-0.

List of Reagents:

UHRF1_SRA protein (supplied by Assay Provider)
FAM labeled Hemimethylated CpG DNA Oligo (IDT-custom order)
FAM labeled Methylated CpG DNA Oligo (IDT-custom order)
Lanthascreen Tb Anti-His Antibody (Invitrogen, part PV5895)
MgCl2 (Fisher, part BP214)
NaCl (Sigma, part S6546)
DTT (Fisher, part BP172)
EDTA (Sigma, part E7889)
Tris (Amresco, part 0497)
Tween 20 (Sigma, part P9416)
Glycerol (Sigma, part G7893)
1536-well plates (Corning, part 7261)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Inhibition at 4.4 uM
4.21
4.21
4.21
4.21
4.21
4.21
4.2
4.2
4.2
4.2
4.2
4.2
4.2
4.2
4.2
4.2
4.2
4.2
4.2
4.2
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:potassium voltage-gated channel subfamily H member 2 isoform a [Homo sapiens]
External ID: herg-kcnh2-3.1-p2-mutant
Protocol: U2OS cells were resuspended in cell media containing 10% fetal calf serum (FCS) at a concentration of 2 million cells / mL. The solution was treated with the mutant (3.1) virus at 1.77 x 10^8 / mL and allowed to incubate at room temperature in the dark. After 4 hours of incubation, DMEM + 10% fetal bovine serum (FBS) was added to the cell solution. Three microliter was then dispensed into a 1536 tissue culture treated black assay plates which were incubated overnight at 37 C. Two microliter of loading buffer (HBSS + HEPES + Red40 dye quencher + FluxOr dye) was added and the assay plates were incubated for 45 min at room temperature in the dark. Twenty-three nanoliter of test compounds and positive control Haloperidol (46 uM final concentration) were added to the assay plate followed by a kinetic read (180 sec) using the Hamamatsu FDSS reader. A stimulation buffer was added to the plate and the second kinetic read (2 min) was obtained. The rate constant was calculated from the kinetic reads and normalized to the positive and negative DMSO controls.
Comment: Compounds that had a max activity < -70% are considered "active" and are assigned a score of 90.
Compounds that had a max activity between > -70% and < -50% are considered "inconclusive" and are assigned a score of 50.
Compounds that had a max activity > -50% are considered "inactive" and are assigned a score of 10.
PhenotypePotencyEfficacyAnalysis CommentActivity_ScoreCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.369 uMActivity at 1.840 uMCompound QC
0-16.5468-16.5468QC'd by "Key Organics Ltd."
0-16.5467-16.5467QC'd by "DPISMR"
0-16.5458-16.5458
0-16.5454-16.5454QC'd by "DPISMR"
0-16.5446-16.5446QC'd by "ChemBridge"
0-16.5432-16.5432QC'd by "ChemBridge"
0-16.5426-16.5426QC'd by "ChemT & I Ltd."
0-16.5412-16.5412QC'd by "Chem Div"
0-16.5396-16.5396QC'd by "DPISMR"
0-16.5359-16.5359QC'd by "DPISMR"
0-16.5312-16.5312QC'd by "Chem Div"
0-16.529-16.529QC'd by "Chem Div"
0-16.5284-16.5284QC'd by "DPISMR"
0-16.5271-16.5271QC'd by "InterBioScreen"
0-16.5256-16.5256QC'd by "Peter Wipf - Univ. of Pittsburgh - MLI CMLD"
0-16.5243-16.5243QC'd by "Chem Div"
0-16.5229-16.5229QC'd by "Asinex Ltd."
0-16.5195-16.5195QC'd by "Specs"
0-16.5174-16.5174QC'd by "ChemBridge"
0-16.5168-16.5168QC'd by "Enamine"
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:N/A
External ID: SBCCG-A1016-RevErbaLBD-Primary-Assay
Protocol: This assay is to identify modulators of Rev-erb alpha protein binding to DNA

A. Materials:
REV-alpha_beta purified protein = Rastinejad lab
FITC-DNA = Rastinejad lab
Tris = Biorad (cat #161-0719)
DTT = Akron Biotechnology (cat #AK2948-0005)
5M NaCl = Sigma-Aldrich (cat #56546-1L)
Glycerol 99.5% = Acros (cat #327255000)
Tween 20 = Sigma-Aldrich (cat #P1379)
Corning high base black plates = Corning (cat #3724)
Molecular grade water = Cellgro (cat #46-000-CM)

B. Plate Map:
Negative (low) control in columns 1 and 2 is 6nM DNA and 35nM Protein, DMSO
Positive (high) control in columns 3 and 4, Protein at 750nM and 6nM DNA, DMSO
Test compound in columns 5 - 48, Protein at 35nM + 6nM DNA + test compound

C. Procedures:
Step#Description
1#Prepare 2X Rev-erb alpha protein stock and 2X DNA stock
2#Using LabCyte Echo, transfer xnL from a 2 mM Echo qualified plate containing test compounds into assay plate Col. 5 - 48. Add same volume of DMSO in col 1-4.
3#Spin plates at 1000 rpm for 1 minute in centrifuge.
4#Using the bioraptr, add 3 uL/well of (35nM protein control) to columns 1 and 2 and test compound wells.
5#Using the bioraptr, add 3 uL/well of Mix 2 (750nM protein) to col. 3-4 for the positive control
6#Using the bioraptr, add 3uL/well of Mix 3 (DNA) to col. 1-48.
7#Spin plates at 1000 rpm for 1 minute in centrifuge.
8#Incubate plates in the dark at room temperature for 90 minutes.
9#Set up Perkin Elmer EnVision as described in section Instrument setting.
10#Read plates on EnVision using FP Dual enhanced mirror, FP 480 excitation filter, FP-P-pol 535 and FP-S-pol 535 emissin filters
Comment: Actives were selected based on, % response = 45% or greater
BatchID%Activity_Corrected at 10 uMValue at 10 uMFRatioMean HighSTD Deviation HighMean LowSTD Deviation Low
MLS-0047618.P030-3.493.68211.044.170.559.390.94
MLS-0047644.P0305.014.11640.924.170.559.390.94
MLS-0047572.P030-2.833.69691.044.170.559.390.94
MLS-0051226.P0300.813.94510.974.170.559.390.94
MLS-0018734.P030-4.413.68651.044.170.559.390.94
MLS-0099666.P0281.273.98090.984.170.559.390.94
MLS-0021904.P031-3.013.78121.014.170.559.390.94
MLS-0003494.P0306.804.21360.884.170.559.390.94
MLS-0041706.P0304.324.15710.934.170.559.390.94
MLS-0051069.P030-3.403.77220.984.170.559.390.94
MLS-0008767.P030-4.323.69821.104.170.559.390.94
MLS-0004317.P030-5.103.65011.054.170.559.390.94
MLS-0024446.P0301.543.9761.004.170.559.390.94
MLS-0043221.P0303.454.13640.944.170.559.390.94
MLS-0093353.P0282.204.08610.934.170.559.390.94
MLS-0039240.P030-3.253.80520.984.170.559.390.94
MLS-0009783.P0250.253.8930.944.170.559.390.94
MLS-0027652.P0311.203.92910.964.170.559.390.94
MLS-0034571.P030-0.403.85850.964.170.559.390.94
MLS-0001714.P0303.944.08250.924.170.559.390.94
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:DNA polymerase iota [Homo sapiens]
External ID: PolI100
Protocol: Three microliters of reagents (buffer in column 3 and 4 as negative control and 10 nM Pol iota in columns 1, 2, and 5-48) will be dispensed into 1,536-well black solid-bottomed plate. Compounds (23 nL) will be transferred via Kalypsys pin tool equipped with 1536-pin array. The plates will then be incubated for 15 min at room temperature, and 1 muL substrate (50 nM final concentration) will be added to start the reaction and kinetically read twice at 0 min and 10 min on the Viewlux reader.
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description". For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.
2. For all inactive compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.00174 uMActivity at 0.00357 uMActivity at 0.00697 uMActivity at 0.016 uMActivity at 0.028 uMActivity at 0.056 uMActivity at 0.105 uMActivity at 0.226 uMActivity at 0.447 uMActivity at 0.627 uMActivity at 0.951 uMActivity at 1.818 uMActivity at 2.333 uMActivity at 4.073 uMActivity at 6.884 uMActivity at 11.29 uMActivity at 15.41 uMActivity at 25.59 uMActivity at 50.19 uMActivity at 58.90 uMActivity at 114.8 uMActivity at 162.0 uMActivity at 229.0 uMCompound QC
Activator10038.2868Single point of activity-44.95490.9173401.713230 0 0 0 030.01325.23092.13492.7977-1.48930.0132QC'd by "Asinex Ltd."
Activator10054.6995Single point of activity-44.95490.906756.29881.599330 0 0 0 042.86936.50444.3471-0.522-3.405842.8693QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-17.247621.616912.731122.870220.8427-17.2476QC'd by "Asinex Ltd."
Activator10074.7794Single point of activity-44.95490.904176.01081.231430 0 0 0 057.88046.71663.01043.7559-6.890557.8804QC'd by "Asinex Ltd."
Activator10053.1278Single point of activity-44.95490.920564.542711.414930 0 0 0 051.512412.068710.669616.44417.363851.5124QC'd by "Asinex Ltd."
Activator89.125188.3489Single point of activity-4.054.95490.850483.4345-4.914430 0 0 0 066.09-2.47732.6993.4126-18.203166.09QC'd by "Asinex Ltd."
Inactive40 0 0 0 028.31327.60447.16211.8797-18.688428.3132QC'd by "Asinex Ltd."
Inactive40 0 0-12.196315.53416.1257-12.1963QC'd by "Asinex Ltd."
Activator70.7946131.9739Single point of activity-4.154.95490.9814124.2791-7.694830 0 0 0113.1868-14.95513.8059-12.5697113.1868QC'd by "Asinex Ltd."
Activator50.118798.8583Partial curve; high efficacy; poor fit-4.32.84730.9993127.119928.26162.30 0 0118.361229.714527.0534118.3612QC'd by "Asinex Ltd."
Activator89.125152.8332Single point of activity-4.054.95490.883946.5982-6.235130 0 0 0 035.9582-5.77850.0051-3.002-11.664535.9582QC'd by "Asinex Ltd."
Activator44.668458.1237Single point of activity-4.353.132163.62375.530 0 060.6935.24975.464660.693QC'd by "Asinex Ltd."
Activator10032Partial curve; partial efficacy; poor fit-44.95490.793342102.40 0 0 0 031.9276.410917.966911.731810.137931.927QC'd by "Asinex Ltd."
Activator70.794652.3872Partial curve; partial efficacy; poor fit-4.153.1320.936688.810636.42342.40 0 079.234143.000930.19579.2341QC'd by "Asinex Ltd."
Inactive40 0 0 0 010.1042-2.0932-3.6864-11.1533-2.230610.1042QC'd by "Asinex Ltd."
Activator35.481394.2201Single point of activity-4.451.71371103.2201931 0 091.996533.49919.888791.9965QC'd by "Asinex Ltd."
Activator89.1251188.8272Single point of activity-4.054.95490.9819184.3761-4.451130 0 0 0 0142.9272-4.94150.87513.8410.2429142.9272QC'd by "Asinex Ltd."
Inactive40 0 0 0 015.1304-16.5373-21.4322-21.4132-27.988115.1304QC'd by "Asinex Ltd."
Activator89.125154.5907Single point of activity-4.054.95490.898243.8763-10.714330 0 0 0 034.3843-5.7785-4.8931-14.2749-14.724834.3843QC'd by "Asinex Ltd."
Activator56.234179.3018Partial curve; high efficacy; poor fit-4.253.1320.9915106.102926.80112.30 0 098.243530.659923.039198.2435QC'd by "Asinex Ltd."
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:N/A
External ID: GDH-TPI_INH_ABS_1536_1X%INH CSRUN
Protocol: Assay Overview:

The purpose of this biochemical counterscreen is to determine whether compounds act as absorbance assay artifacts or are non-selective. This assay also serves as a counterscreen for a set of ongoing high throughput primary experiments entitled, "Absorbance-based biochemical primary high throughput screening assay to identify inhibitors of the aldolase of M. tuberculosis."

This counterscreen is similar in format to the aforementioned assay with the only two following differences: (i) the fructose-1,6-bisphosphate substrate is replaced with glyceraldehyde 3 phosphate, a product of its conversion by FBA and (ii) no (FBA) is used. The counterscreen hence recapitulates the two steps involved in the monitoring of FBA activity through the conversion of FB into the triose product glyceraldehyde 3 phosphate (G3P), which would be converted to dihydroxyacetone phosphate (DHAP) by the helper enzyme triose phosphate isomerase (TPI). A second helper enzyme, glycerophosphate dehydrogenase (GDH), converts the dihydroxyacetone phosphate to glycerol-3-phosphate with the concomitant oxidation of NADH to NAD, which is monitored by measuring the absorbance at 340 nm. In this new assay format, the A340 is independent of FBA activity, hence compounds that reduce absorbance at 340 nm are either absorbance artifacts or helper enzyme inhibitors that will not be pursued. Compounds are tested in singlicate at a final nominal concentration of 4.78 uM.

Protocol Summary:

Prior to the start of the assay, 5 uL /well of Buffer A (50 mM HEPES, 0.01% Triton X-100, 10% Glycerol, pH8.0) supplemented with 400 nM ZnCl2,240 uM NADH and the helper enzymes GDH-TPI (4 U/mL) was dispensed into all wells of a 1536-well plate except the "No enzyme" wells that contained the same supplemented buffer but no GDH-TPI enzymes. Next, 48 nL of test compounds were then delivered in each well using a PinTool. The assay was then initiated by dispensing 5 uL of Buffer A supplemented with 240 uM of the substrate glyceraldehyde-3-phosphate (G3P). Plates were incubated at room temperature for 20 minutes before A340 was measured using the EnVision plate reader (Perkin Elmer).

The percent inhibition for each compound was calculated as follows:

%Inhibition = 100 * ( ( Test_Compound - Median_Low_Control ) / ( Median_High_Control - Median_Low_Control ) )

Where:

Test_Compound is defined as wells treated with test compounds.
Low_Control is defined as wells treated with DMSO.
High_Control is defined as wells with no GDH-TPI enzyme.

A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Two values were calculated for each assay plate: (1) the average percent inhibition of test compound wells and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter for each plate, i.e. any compound that exhibited greater % inhibition than the cutoff parameter was declared active.

PubChem Activity Outcome and Score:

The reported PubChem Activity Score has been normalized to 100% observed inhibition. Negative % inhibition values are reported as activity score zero.

The PubChem Activity Score range for active compounds is 100-13, and for inactive compounds 13-0.

List of Reagents:

ZnCl2 (Fisher Scientific, part Z33-500)
NADH (EMD Biosciences, part 481913)
GDH-TPI (Sigma, part G1881)
HEPES (EMD Biosciences, part EM-5310)
Triton X-100 (Sigma, part T8787)
Glycerol (Fisher, part AC327255000)
Glyceraldehyde-3-phosphate (Sigma, part D7137)
1536-well plates (Aurora, part 1091-11020-S)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. In this case the results of each separate campaign were assigned "Active/Inactive" status based upon that campaign's specific compound activity cutoff value. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, and compounds that quench or emit absorbance within the well. All test compound concentrations reported are nominal; the specific concentration for a particular test compound may vary based upon the actual sample provided by the MLSMR
Inhibition at 4.8 uM
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
11.19
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:DNA polymerase eta [Homo sapiens]
External ID: PolE100
Protocol: Three microliters of reagents (buffer in column 3 and 4 as negative control and 10 nM Pol eta in columns 1, 2, and 5-48) were dispensed into a 1,536-well black solid-bottomed plate. Compounds (23 nL) were transferred via Kalypsys pin tool equipped with 1536-pin array. The plates were then incubated for 15 min at room temperature, and 1 muL substrate (50 nM final concentration) was added to start the reaction and kinetically read twice at 0 min and 10 min on the Viewlux reader
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description". For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.
2. For all inactive compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.00366 uMActivity at 0.018 uMActivity at 0.091 uMActivity at 0.457 uMActivity at 2.290 uMActivity at 11.40 uMActivity at 57.10 uMActivity at 114.0 uMCompound QC
Inactive4-18.6944-16.4688-21.0535-18.6569-21.2387-18.6944QC'd by "Chem Div"
Inactive40 0 0 0 0-10.5731-6.3238-5.0728-10.0177-9.1591-10.5731QC'd by "Chem Div"
Inactive40 0 0 0 0-20.9106-9.1883-14.5238-10.32-16.7599-20.9106QC'd by "Chem Div"
Inactive40 0 0 0 0-14.976-6.1336-5.9392-8.0291-13.3224-14.976QC'd by "Chem Div"
Inactive40 0 0 0 0-17.0295-7.3413-7.7338-7.023-12.9903-17.0295QC'd by "Chem Div"
Inactive40 0 0 0 0-7.64567.56026.26025.9483.5763-7.6456QC'd by "Chem Div"
Inhibitor56.234151.8151Partial curve; partial efficacy; poor fit-4.252.33320.9681-53.5412-1.7261-2.40 0 0 0 0-52.4914-0.4336-0.9826-4.7322-25.7264-52.4914QC'd by "Chem Div"
Inactive40 0 0 0 0-11.9031-7.9949-12.5613-13.3404-9.3154-11.9031QC'd by "Chem Div"
Inactive40 0 0 0 0-18.42360.2580.8315-1.6401-6.8466-18.4236QC'd by "Chem Div"
Inactive4-17.2118-16.2591-19.8884-17.4024-20.0078-17.2118QC'd by "Chem Div"
Inactive40 0 0 0 0-16.8313-10.0087-8.8391-10.5867-9.3418-16.8313QC'd by "Chem Div"
Inactive40 0 0 0 0-6.7293-13.0106-9.8363-10.4044-13.1352-6.7293QC'd by "Chem Div"
Inactive4-0.6109-0.5083.9691.39623.5402-0.6109QC'd by "Chem Div"
Inactive40 0 0 0 0-19.2263-10.4317-10.645-12.9544-8.0548-19.2263QC'd by "Chem Div"
Inactive40 0 0 0 1-19.5782-17.1915-17.4143-17.6927-30.3966-19.5782QC'd by "Chem Div"
Inactive40 0 0 0 0-17.5302-9.8783-9.1532-13.5844-9.2694-17.5302QC'd by "Chem Div"
Inactive4-11.9062-9.7368-9.5071-10.0381-13.0691-11.9062QC'd by "Chem Div"
Inactive4-19.9153-18.2374-18.6714-22.0089-21.7411-19.9153QC'd by "Chem Div"
Inactive40 0 0 0 014.59351.8292.48512.7485-0.704414.5935QC'd by "Chem Div"
Inactive40 0 0 0 0-10.4477-8.2332-4.1692-6.4251-8.3536-10.4477QC'd by "Chem Div"
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:N/A
External ID: SBCCG-A1014-TWEAK-Fn14-Primary-Assay
Protocol: A. Brief Description of the Assay:
This assay attempts to identify small molecule inhibitors of TWEAK-Fn14 interactions, using a cell-based reporter assay. The assay is run in 1536-well format and is measured via luminescence.

B. Assay Procedures:

Day 1#
1.#Harvest cells. Spin, resuspend in 10% FBS DMEM
2.#Split cell at 1:6
3.#Incubate the flasks for 48hr prior to the experiment day in 37 C 5% CO2 incubator.
#
Day 3#
1.#Harvest cells. Spin, resuspend in Opti-MEM and count.
2.#Dilute cell to 0.25 x106 c/mL.
3.#Prime the Multidrop Combi with 5ml Opti-MEM and add 4microL Assay media to full plate.
a.#>>Plate with Multidrop Combi.
4.#Spin plates at 1000 RPM for 1 min, lid plate.
5.#Incubate plate overnight in 37 C 5% CO2 incubator.
#
Day 4#
1.#Transfer compound (10mM) and DMSO using LabCyte ECHO Dose Response protocol.
2.#Spin plates at 1000 RPM for 1 min.
3.#Incubate plate for 1 hour in 37 C 5% CO2 incubator.
4.#Transfer 2microL of Human TWEAK (120ng/ml) using Multidrop Combi.
5.#Spin plates at 1000 RPM for 1 min and incubate plate for 8 hours in 37 C 5% CO2 incubator.
6.#Add 2.5 microL of Bright Glo reagent and spin the plates at 1000rpm for 1min.
7.#Incubate at RT for 5 min.
8.#Read plate with PerkinElmer ViewLux.

C. Plate Map:

Positive (Low) control in column 1-4, DMSO.
Negative (High) control in columns 45-48, DMSO.
Test wells in columns 5-44.
Comment:
%Activity_Corrected at 10 uMValue at 10 uMMean HighSTD Deviation HighMean LowSTD Deviation Low
-16.417046.1995736.841539.88822.02236.26
-7.996489.9985736.841539.88822.02236.26
2.665170.6725736.841539.88822.02236.26
-7.876645.1655736.841539.88822.02236.26
4.915426.5495736.841539.88822.02236.26
10.765338.8255736.841539.88822.02236.26
-1.385994.515736.841539.88822.02236.26
36.643912.0095736.841539.88822.02236.26
-11.536222.6655736.841539.88822.02236.26
12.295713.4395736.841539.88822.02236.26
28.814508.0765736.841539.88822.02236.26
-15.616523.3125736.841539.88822.02236.26
2.865454.655736.841539.88822.02236.26
-2.966844.0795736.841539.88822.02236.26
31.864672.6955736.841539.88822.02236.26
4.366032.0495736.841539.88822.02236.26
3.046638.0595736.841539.88822.02236.26
-10.946877.2845736.841539.88822.02236.26
16.35502.5165736.841539.88822.02236.26
54.713120.3435736.841539.88822.02236.26
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:DNA polymerase kappa [Homo sapiens]
External ID: PolK100
Protocol: Three microliters of reagents (buffer in column 3 and 4 as negative control and 10 nM Pol kappa in columns 1, 2, and 5-48) were dispensed into a 1536-well black solid-bottom plate. Compounds (23 nL) were transferred via Kalypsys pin tool equipped with 1536-pin array. The plates were then incubated for 15 min at room temperature, and 1 uL substrate (50 nM final concentration) were then added to start the reaction and kinetically read twice at 0 min and 10 min on the Viewlux reader
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description". For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.
2. For all inactive compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.0003270000 uMActivity at 0.0007732774 uMActivity at 0.00163 uMActivity at 0.00369 uMActivity at 0.00818 uMActivity at 0.020 uMActivity at 0.030 uMActivity at 0.047 uMActivity at 0.101 uMActivity at 0.151 uMActivity at 0.243 uMActivity at 0.477 uMActivity at 0.759 uMActivity at 1.287 uMActivity at 2.393 uMActivity at 3.818 uMActivity at 6.336 uMActivity at 11.99 uMActivity at 19.37 uMActivity at 31.37 uMActivity at 60.11 uMActivity at 107.2 uMActivity at 158.4 uMActivity at 229.0 uMCompound QC
Inactive40 0 0 0 01.4694-3.5669-6.2352.85861.80421.4694QC'd by "Chem Div"
Inactive40 0 0 0 0-4.26318.22188.081110.2927-3.9947-4.2631QC'd by "Chem Div"
Inactive40 0 0 0 06.03690.3398-2.1048-8.1695-3.68226.0369QC'd by "Chem Div"
Inactive4-2.05651.7294-3.5894-1.2575-0.5402-2.0565QC'd by "Chem Div"
Inactive40 0 0 0 12.31491.00484.6369-1.9963-3.35432.3149QC'd by "Chem Div"
Inactive47.27487.15156.13721.51975.23327.2748QC'd by "Chem Div"
Inactive40 0 0 0 01.006-3.3873-7.786-9.3037-9.17611.006QC'd by "Chem Div"
Inactive40 0 0 0 0-0.0368-9.4458-10.5155-9.0065-12.9141-0.0368QC'd by "Chem Div"
Inactive40 0 0 0 02.6-7.8084-12.3007-2.0954-6.68872.6QC'd by "Chem Div"
Inactive40 0 0 0 0-11.4867-18.9051-17.4955-19.0735-9.6682-11.4867QC'd by "Chem Div"
Inactive40 0 0 0 0-7.5605-17.2173-11.0038-16.5656-22.4025-7.5605QC'd by "Chem Div"
Inactive4-7.5451-1.1939-1.3084-5.8268-5.3206-7.5451QC'd by "Chem Div"
Inactive40 0 0 0 1-5.5852-4.3753-1.0046-3.1641-10.1524-5.5852QC'd by "Chem Div"
Inactive40 0 0 0 01.1172-6.03917.01189.04461.65331.1172QC'd by "Chem Div"
Inactive42.33591.25181.6626-0.9325-0.91942.3359QC'd by "Chem Div"
Inactive40 0 0 0-19.53540.3984-4.11472.1883-19.5354QC'd by "Chem Div"
Inactive4-5.6552-4.6769-1.9378-0.5867-3.224-5.6552QC'd by "Chem Div"
Inactive4-11.3738-10.4148-13.8912-10.4252-7.8961-11.3738QC'd by "Chem Div"
Inactive4-6.1571-8.7102-2.9113-5.2229-3.4369-6.1571QC'd by "Chem Div"
Inactive40 0 0 0 1-7.3803-8.8177-11.1654-6.5301-15.9483-7.3803QC'd by "Chem Div"
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:Protein DAF-12, isoform a [Caenorhabditis elegans]
External ID: HGDAF12_AG_LUMI_1536_1X%ACT PRUN
Protocol: Assay Overview:

The purpose of this assay is to identify compounds that act as agonists of the nuclear receptor daf-12. In this assay, CV-1cells are co-transfected with a GAL4-responsive reporter plasmid (UAS-tk-luc) and expression vector encoding GAL4-hgDAF12. The ability of compounds to increase transcriptional activity is assessed by measuring luciferase expression from the reporter gene plasmid. Compounds were tested in singlicate at a final nominal concentration of 6.8 micromolar.

Protocol Summary:

HEK293 cells were routinely cultured in T-175 flasks containing 25 mL of DMEM media supplemented with 10% v/v fetal bovine serum and 1% v/v antibiotic-antimycotic mix at 37 C, 5% CO2 and 95% relative humidity (RH). The day prior to run the assay, the HEK293 cells were harvested using 5 mL of TrypLE reagents and seeded in fresh media at a density of 10 million cells per T175 flask. The following day, cells were transfected with 1 mL of serum-free OptiMEM containing 8 ug of the hgDAF12-expressing vector, 20 ug of the MH1000-tk-luc reporter plasmid and 80 uL of transfection reagent. Twenty four hours post transfection, cells were harvested using 5 mL of preheated TrypLE and resuspended at a concentration of 1 million cells per mL in phenol-red free DMEM supplemented as above. Sodium butyrate, a compound shown to increase the luminscent signal in this assay, was used as a positive control.

The assay was started by dispensing 5 uL of cell suspension into each well of white, solid-bottom 1536-well plates using a flying reagent dispenser (Aurora) and placed in the incubator for 3 hours. Cells were then treated with 34 nL/well of either test compounds, DMSO (Low Control, final concentration 0.68%) or 2 mM of Sodium Butyrate (High Control). Plates were incubated for 24 hours at 37 C, 5% CO2 and 95%RH and then removed from the incubator and equilibrated to room temperature for 10 minutes. Luciferase activity was detected by addition of 5 uL of One-Glo reagent to each well. After a 15 minute incubation time, light emission was measured with the ViewLux reader (PerkinElmer).

The percent activation of each test compound was calculated as follows:

%_Activation = 100 * ( ( Test_Compound - Median_Low_Control ) / ( Median_High_Control - Median__Low_Control ) )

Where:

High_Control is defined as wells treated with 2 mM Sodium Butyrate
Low_Control is defined as wells treated with DMSO only.
Test_Compound is defined as wells treated with test compound.

PubChem Activity Outcome and Score:

A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Two values were calculated: (1) the average percent inhibition of all compounds tested, and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter, i.e. any compound that exhibited greater % inhibition than the cutoff parameter was declared active.

The reported PubChem Activity Score has been normalized to 100% observed primary activation. Negative % activation values are reported as activity score zero.

The PubChem Activity Score range for active compounds is 100-12, and for inactive compounds 12-0.

List of Reagents:

MH1000-tk-luc luciferase reporter plasmid (Assay Provider)
hgDAF12 expressing plasmid (Assay Provider)

List of Consumables:

Sodium Butyrate (Sigma, part B5887)
HEK293 cells (ATCC, part CRL-1573)
DMEM (Invitrogen, part 11965)
FBS (Hyclone, part SH30088.03)
Antibiotic-Antimycotic 100X Liquid Solution (Gibco, part 15240)
TransIT 293 (Mirus Corporation, part MIR-2700)
OptiMEM (Invitrogen, part 31985)
TrypLE Trypsin Replacement Enzyme (Invitrogen, part 12604)
One-Glo (Promega, part E6130)
1536-well plates (Greiner part 789173)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, and compounds that modulate luciferase activity and hence well luminescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.

In absence of a Protein Entry for the DAF-12 protein from H. glycines in NCBI's database, links to the target sequence and origin refer to the closest known orthologue from the prototypic parasitic helminth C.elegans.
Activation at 6.8 uM
62.09
60.25
59.18
53.21
50.22
48.95
47.43
45.92
42.05
38.56
36.82
34.13
32.75
32.06
31.73
31.3
28.81
28.09
28
27.93
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:thioredoxin reductase [Rattus norvegicus]
External ID: TRXR100
Protocol: Assay protocol: 2 uL of reagents (buffer in column 4 as negative control and 90 nM rTrxR1 in columns 1-3 and 5-48) were dispensed into Greiner black solid-bottom 1,536-well assay plates, followed by 1 uL of NADPH (400 uM final concentration) to each well. The plates were centrifuged at 1000 rpm for 15 seconds and subsequently incubated for 5 min at room temperature (~22 deg C) to allow for rTrxR1 reduction. Compounds (23 nL) were then transferred via Kalypsys pin tool equipped with 1536-pin array (10 nL slotted pins, V&P Scientific, San Diego, CA). In addition, a duplicate 2-fold serial dilution of the control compounds auranofin, a known gold-based TrxR1 inhibitor, and juglone (5-hydroxy-1,4-naphthoquinone), a natural TrxR1 substrate, were pin-transferred to columns 2 and 3, respectively. After incubation for 15 min at room temperature (~22 deg C), 1 uL of selenite (400 uM final concentration) were dispensed to each well. The plate was immediately transferred to a ViewLux high-throughput CCD imager (PerkinElmer), wherein kinetic measurements of NADPH fluorescence (Ex 340 nm, Em 450 nm) were acquired (8 minute kinetic read, see Table 1). Read 1 was utilized to assess the capacity of a compound to serve as an rTrxR1 substrate, i.e. a decrease in NADPH fluorescence compared to the no-compound background is an indication of a substrate behavior for that particular compound. For inhibitory activity of a compound, delta values, computed as the difference in fluorescence intensity between the first and last reads of an 8-minute time kinetic window, were used. All reagents were diluted in an assay buffer consisting of 50 mM Tris-HCl, pH 7.5, 2 mM EDTA, and 0.01% Tween-20.

Throughout the screen, reagent bottle and all liquid lines were made light-tight to minimize reagent degradation. All screening operations were performed on a fully integrated robotic system (Kalypsys, San Diego, CA) containing one RX-130 and two RX-90 anthropomorphic robotic arms (Staubli, Duncan, SC). Library plates were screened starting from the lowest and proceeding to the highest concentration, and a 'double-pinning' step of the highest concentration was required to access higher concentrations of compounds. Vehicle-only plates, with DMSO being pin-transferred to the columns 5-48, were inserted uniformly at the beginning and the end of each library in order to monitor and record any shifts in the background, which can be affected by reagent dispensers or loss in enzyme activity over time. Screening data were corrected, normalized, and concentration-effect relationships were derived by using publicly-available curve fitting algorithms developed in-house (http://ncgc.nih.gov/pub/openhts).
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description". For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.

2. For all inactive compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.00366 uMActivity at 0.018 uMActivity at 0.023 uMActivity at 0.046 uMActivity at 0.073 uMActivity at 0.091 uMActivity at 0.165 uMActivity at 0.229 uMActivity at 0.457 uMActivity at 0.575 uMActivity at 0.940 uMActivity at 1.600 uMActivity at 2.289 uMActivity at 3.140 uMActivity at 4.699 uMActivity at 9.139 uMActivity at 11.40 uMActivity at 21.25 uMActivity at 28.60 uMActivity at 57.06 uMActivity at 80.69 uMActivity at 114.0 uMActivity at 162.0 uMActivity at 229.0 uMCompound QC
Inactive40 0 0 0 0 0-8.53574.3179-3.078218.20441.4021-0.6071-8.5357QC'd by "Asinex Ltd."
Inhibitor14.125494.1071Partial curve; partial efficacy-4.8510.9973-87.10717-2.20 0 0 0 0-69.13267.67153.9436-8.8651-33.8049-69.1326QC'd by "Asinex Ltd."
Inactive40 0 0 0 120.214423.2666.5523.98665.684720.2144QC'd by "Asinex Ltd."
Inactive40 0 0 0-2.434528.6217.595528.0695-2.4345QC'd by "Asinex Ltd."
Inactive40 0 0 0 0 1-7.2095-7.735-9.4851-7.98121.2883-3.8441-7.2095QC'd by "Asinex Ltd."
Inactive40 0 0 0 0 01.10243.00585.11918.562210.09352.8321.1024QC'd by "Asinex Ltd."
Inactive40 0 0 0 0 0-16.916816.733920.466617.039614.98343.2447-16.9168QC'd by "Asinex Ltd."
Inactive40 0 0 0 016.953.651810.700612.160917.923916.95QC'd by "Asinex Ltd."
Inactive47.83587.23477.1972-0.99415.73765.37157.8358QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-0.78149.89919.35416.63937.5499-0.7814QC'd by "Asinex Ltd."
Inactive40 0 0 0 120.476721.53514.991212.943922.639120.4767QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-11.37245.1415-7.4919-12.7916-0.0848-11.3724QC'd by "Asinex Ltd."
Inactive40 0 0 0 0 0-4.73344.063716.947420.368612.983914.7116-4.7334QC'd by "Asinex Ltd."
Inactive45.303513.9672-6.20068.7377.44159.30535.3035QC'd by "Asinex Ltd."
Inactive413.734115.38238.816212.893614.076613.7341QC'd by "Asinex Ltd."
Inhibitor25.118970.1972Single point of activity-4.61.64360.9919-61.69728.5-30 0 0 0 0-47.434110.32869.74593.6414-5.394-47.4341QC'd by "Asinex Ltd."
Inactive43.48442.43732.78442.02692.78233.4844QC'd by "Asinex Ltd."
Inactive40 0 0 0 0 11.62676.04552.25593.90257.0096-5.30151.6267QC'd by "Asinex Ltd."
Inactive40 0 0 0 0 0-35.82349.26788.562721.11442.8518-2.6144-35.8234QC'd by "Asinex Ltd."
Inactive41 0 0 0 0 0-8.421932.42926.16398.859110.323711.673-8.4219QC'd by "Asinex Ltd."
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:potassium voltage-gated channel subfamily H member 2 isoform a [Homo sapiens]
External ID: herg-kcnh2-3.1-p2-wildtype
Protocol: U2OS cells were resuspended in cell media containing 10% fetal calf serum (FCS) at a concentration of 2 million cells / mL. The solution was treated with the Wild-type virus at 2.03 x 10^8 / mL and allowed to incubate at room temperature in the dark. After 4 hours of incubation, DMEM + 10% fetal bovine serum (FBS) was added to the cell solution. Three microliter was then dispensed into a 1536 tissue culture treated black assay plates which were incubated overnight at 37 C. Two microliter of loading buffer (HBSS + HEPES + Red40 dye quencher + FluxOr dye) was added and the assay plates were incubated for 45 min at room temperature in the dark. Twenty-three nanoliter of test compounds and positive control Haloperidol (46 uM final concentration) were added to the assay plate followed by a kinetic read (180 sec) using the Hamamatsu FDSS reader. A stimulation buffer was added to the plate and the second kinetic read (2 min) was obtained. The rate constant was calculated from the kinetic reads and normalized to the positive and negative DMSO controls.
Comment: Compounds that had a max activity < -70% are considered "active" and are assigned a score of 90.
Compounds that had a max activity between > -70% and < -50% are considered "inconclusive" and are assigned a score of 50.
Compounds that had a max activity > -50% are considered "inactive" and are assigned a score of 10.
PhenotypePotencyEfficacyAnalysis CommentActivity_ScoreCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.369 uMActivity at 1.840 uMCompound QC
0-0.0491-0.0491QC'd by "Asinex Ltd."
0-0.0466-0.0466QC'd by "Asinex Ltd."
0-0.0434-0.0434QC'd by "Asinex Ltd."
0-0.0372-0.0372QC'd by "Asinex Ltd."
0-0.0347-0.0347QC'd by "Asinex Ltd."
0-0.0329-0.0329QC'd by "Asinex Ltd."
0-0.0322-0.0322QC'd by "Asinex Ltd."
0-0.0316-0.0316QC'd by "Asinex Ltd."
0-0.0305-0.0305QC'd by "Asinex Ltd."
0-0.027-0.027QC'd by "Asinex Ltd."
0-0.0258-0.0258QC'd by "Asinex Ltd."
0-0.0223-0.0223QC'd by "Asinex Ltd."
0-0.0183-0.0183QC'd by "Asinex Ltd."
0-0.0162-0.0162QC'd by "Asinex Ltd."
0-0.0143-0.0143QC'd by "Asinex Ltd."
0-0.0139-0.0139QC'd by "Asinex Ltd."
0-0.0122-0.0122QC'd by "Asinex Ltd."
0-0.012-0.012QC'd by "Asinex Ltd."
0-0.0101-0.0101QC'd by "Asinex Ltd."
0-0.0088-0.0088QC'd by "Asinex Ltd."
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:
External ID: sca2-steadyglo_p
Protocol: PROTOCOL TABLE (as described by Inglese J, Shamu CE and Guy RK. 2007)
SEQUENCE No. (e.g., 1, 2, 3, etc.); PARAMETER (e.g., Cells, Incubation, Reagent, etc.); VALUE; DESCRIPTION.
1; Cells; 4 uL; white, solid bottom, 1536-well Greiner assay plate.
2; Incubation; 2 hr; 37 degree C in 5% humidified CO2.
3; Compounds; 23 nL; Kalypsis pintool (Wako USA) equipped with a 1536-well pin head.
4; Incubation; 24 hr; 37 degree C in 5% humidified CO2.
5; Reagent; 1 uL; Gly-Phe-7-Amino-4-trifluoromethylcoumarin.
6; Incubation; 30 min; 37 degree C in 5% humidified CO2.
7; Detection; Fluorescence; ViewLux plate reader (PerkinElmer).
8; Reagent; 3 uL; SteadyGlo luciferase solution (Promega).
9; Incubation; 5 min; room temperature.
10; Detection; Luminescence; ViewLux plate reader (PerkinElmer).

NOTES (numbers refer to Sequence numbers above)
1. S2 cells expressing ATXN2-luciferase reporter were suspended in phenol-red free DMEM and dispensed in assay plates using a Multidrop Combi dispenser (Thermo Fisher Scientific). Wells containing medium only were plated on each plate, and values were used to normalize (100% inhibition) in the luciferase and CellTiter-Fluor assays.
2. Assay plates were incubated. Evaporation was prevented by covering assay plates with metal lids containing holes to allow gas diffusion.
3. Compounds were added in a dose response manner with the final concentrations of 57, 11.4, 2.28, 0.46, 0.091, 0.018, 0.0037 uM. Vehicle-only plates, with DMSO being pin-transferred to columns 5-48, were inserted uniformly at the beginning and the end of each library to monitor and record any shifts in assay performance.
5. 125 uM Gly-Phe-7-Amino-4-trifluoromethylcoumarin (MP Biomedicals) working concentration was used at a final concentration of 25 uM.
7. To assess cell viability; the assay plates were read using the ViewLux high-throughput CCD imager (PerkinElmer), wherein single end-point fluorescence measurement was acquired (excitation 405/10; emission 540/25 nm).
8. Detection reagent SteadyGlo Luciferase (Promega) was added to the assay plate.
10. Luminescence is then measured on the ViewLux imager equipped with a clear emission filter using a 2 sec exposure. All screening operations were performed on a fully integrated robotic system (Kalypsys) containing one RX-130 and two RX-90 anthropomorphic robotic arms (Staubli).

REFERENCES:
Inglese J, Shamu CE and Guy RK, Reporting data from high throughput screening of small molecule libraries, Nature Chemical Biology, 2007, 3(8): 438-441. doi.org/10.1038/nchembio0807-438.
Comment: Disclaimer:
Although all reasonable efforts have been made to ensure the accuracy and reliability of the data, caution should be exercised when interpreting the results as artifacts are possible from nonspecific effects such as assay signal interference. The curve fitting and activity calls presented here are based on the NCATS analysis methods.

Compound Ranking:
1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.
2. For all inactive compounds, with a ratio activity curve class of 4, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. For a ratio activity curve class = -1.1, score = 80+abs((log_ac50+4.5)*inf_activity/20). For ratio.curve_class == -1.2 && abs(ratio.max_response) > 6*10, score = 60+abs((log_ac50+4.5)*inf_activity/20). For ratio.curve_class == -2.1 || ( ratio.curve_class==-2.2 && abs(ratio.max_response) > 6*10), score = 40+abs((log_ac50+4.5)*inf_activity/20). For ratio.curve_class == -1.2 || ratio.curve_class == -2.2, score = 20+abs((log_ac50+4.5)*inf_activity/20). Inconclusive compounds, with a donor curve class other than 4, have PUBCHEM_ACTIVITY_SCORE of 10. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39.
PhenotypePotencyEfficacyAnalysis CommentActivity_ScoreCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.0000389080 uMActivity at 0.0001066275 uMActivity at 0.0001907270 uMActivity at 0.0004540328 uMActivity at 0.0007572215 uMActivity at 0.0009786446 uMActivity at 0.00290 uMActivity at 0.00451 uMActivity at 0.00876 uMActivity at 0.015 uMActivity at 0.026 uMActivity at 0.053 uMActivity at 0.081 uMActivity at 0.235 uMActivity at 0.460 uMActivity at 0.709 uMActivity at 1.038 uMActivity at 2.223 uMActivity at 5.554 uMActivity at 11.31 uMActivity at 18.91 uMActivity at 25.62 uMActivity at 56.99 uMActivity at 115.7 uMActivity at 221.8 uMActivity at 288.0 uMCompound QC
Inactive042.3627-1.83840.97362.7692-6.811610.608-9.3295-56.763-12.31270.57957.23242.3627QC'd by SigmaAldrich
Inactive0-4.51414.95490.572322.51.112340 0 0 0 0 0 0 0 0 0 021.6963-1.39272.4941-5.3231-2.3094-0.47615.2087-4.14282.25061.63622.818121.6963QC'd by BIOMOL
Inactive0-8.11410.60.606519-241 0 0 0 0 0 0 0 0 0 015.9551-25.09624.955110.442211.132413.606820.895214.523414.555527.098317.643215.9551QC'd by Tocris
Inactive0-4.61413.06540.7875-17.83926.540 0 0 0 0 0 0 0 0 0 0-16.53276.581215.210810.12572.1473.35956.79093.25014.35496.2493-0.5643-16.5327QC'd by Tocris
Inactive04-1.74531.93162.40851.62774.63811.55222.50752.35313.96978.48790.0327-1.7453QC'd by BIOMOL
Inactive0-4.31414.95490.6935-23.7101040 0 0 0 0 0 0 0 0 0 0-16.4251-5.59111.1441-6.5191-1.217-0.63721.57633.9012.48061.97740.2599-16.4251QC'd by BIOMOL
Inactive0-4.66413.92950.6373-16.64882.540 0 0 0 0 0 0 0 0 0 0-16.3745.65591.7906-4.5705-6.89536.10464.24993.31416.92735.3525-4.468-16.374QC'd by BIOMOL
Inactive0-4.31414.95490.4902-23.783-0.540 0 0 0 0 0 0 0 0 0 0-16.9025-2.06667.138-6.965-0.12665.83090.3157-2.3556-10.36541.10380.6509-16.9025QC'd by Tocris
Inactive0-4.56414.50450.410521340 0 0 0 0 0 0 0 0 0 02.335415.497814.042710.14959.895217.7354.626113.566217.997811.978611.19012.3354QC'd by Tocris
Activator0.004327.66120Complete curve; partial efficacy-8.36413.29750.65794-23.66121.21 0 0 0 0 0 0 0 0 0 0-4.3551-32.7811-17.63431.62983.17989.471412.78253.18725.21822.0742-1.3727-4.3551QC'd by SigmaAldrich
Inactive0-6.41414.95490.5517-7.16964.540 0 0 0 0 0 0 0 0 0 0-8.4812-6.30037.01386.60416.34737.26234.356-8.6256-9.64313.1993-13.058-8.4812QC'd by BIOMOL
Inactive0-4.61411.44870.7435-15.26876.540 0 0 0 0 0 0 0 0 0 0-11.057310.06734.63033.32295.36510.24964.116112.74941.25174.4953-2.3092-11.0573QC'd by BIOMOL
Inactive0-5.96412.33320.8302-3.462714.540 0 0 0 0 0 0 0 0 0 0-3.192519.249920.31819.81299.965211.608916.89619.9355-1.98791.0088-7.4689-3.1925QC'd by SIGMA
Activator27.282436.61280Single point of activity-4.56414.0950.825235.3387-1.274130 0 0 0 0 0 0 0 0 0 033.70989.34823.35390.6827-9.8386-2.9593-1.1813-1.6759-5.2524-3.31295.710333.7098QC'd by Tocris
Inactive0-5.71412.40640.504911-5.238840 0 0 0 0 0 0 0 0 0 05.41976.54525.2021-11.8205-13.5849-15.199-2.6782-4.01734.12419.433117.7195.4197QC'd by Tocris
Inactive04-5.6859-10.3996-3.2778-8.7479-13.5578-10.8099-16.1474-15.1368-3.1261-6.8761-13.1475-5.6859QC'd by Tocris
Inactive0-7.21410.70.426482240 0 0 0 0 0 0 0 0 0 012.32510.960825.245522.15817.64210.480212.545913.84024.75094.977311.888612.325QC'd by BIOMOL
Activator21.671228.99230Partial curve; partial efficacy; poor fit-4.66413.92950.6883323.00772.40 0 0 0 0 0 0 0 0 0 031.11329.470114.68163.9423-1.89740.4850.50218.04698.282-2.493615.388831.1132QC'd by Tocris
Inactive0-5.71412.72020.8351-5.12911140 0 0 0 0 0 0 0 0 0 0-5.94097.61158.10845.746213.178516.781815.47339.59151.4277-3.8135-4.7653-5.9409QC'd by SIGMA
Activator27.282426.22240Partial curve; partial efficacy; poor fit-4.56411.96730.7623281.77762.40 0 0 0 0 0 0 0 0 0 024.0356.81375.82-5.6020.74664.30282.1745-3.07565.3482.78559.367524.035QC'd by BIOMOL
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:N/A
External ID: SMAD3201
Protocol: Suspensions of trypsinized HEPG2 CAGA-GFP cells were dispensed into white, tissue culture-treated, solid 1536-well plates at 5uL/well (1000 cells/well final concentration) in DMEM medium supplemented with 1% FBS. Plates were incubated at 37 degrees C for 2 hours, after which 23 nL of compounds or DMSO were delivered to each well using a pin tool. One uL of recombinant TGF-beta in DMEM (1% FBS) was then dispensed (500 pg/mL final concentration), and plates were incubated at 37 degrees C for 18 hours. Two uL of CellTiter Glo (Promega), a luminescence-based viability reagent, was dispensed, followed by a 10 minute room temperature incubation. The plates were then measured on a PerkinElmer ViewLux plate reader for luminescence (clear filter) using a 5 second exposure. The %Activity was determined from the corrected luminescence values. Wells containing media only (no cells) were used to normalize %Activity of identified toxic compounds; media-only wells corresponded to 100%Activity (complete cell-killing), while DMSO-dosed cell controls were used to normalize 0%Activity (no toxicity).

Concentration-response curves were fitted to the signals arising from the resulting luminescence. The concentration-effect curves were then classified based on curve quality (r2), response magnitude and degree of measured activity, and compounds were subsequently categorized based on their curve class. Toxic compounds showed concentration-dependent decreases in luminescence, concordant with a decrease in intracellular ATP concentration (CellTiter Glo's marker of viability), and thus a decrease in the number of viable cells. Inactive (non-toxic) compounds showed no effect on luminescence signal. Active (toxic) compounds showed concentration dependent decrease in luminescence.
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description".

2. For all inactive (non-toxic) compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active (toxic) compounds, a score range was given for each curve class type given above. Active (toxic) compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.018 uMActivity at 0.037 uMActivity at 0.074 uMActivity at 0.164 uMActivity at 0.369 uMActivity at 0.461 uMActivity at 0.737 uMActivity at 0.922 uMActivity at 1.840 uMActivity at 2.300 uMActivity at 3.690 uMActivity at 4.610 uMActivity at 9.233 uMActivity at 20.57 uMActivity at 46.10 uMActivity at 92.20 uMCompound QC
Inactive40 0 0 0 00.259610.7694.1255-1.6909-0.74870.2596QC'd by "Chem Div"
Inactive40 0 0 0 0-0.8876-5.2018-3.67070.33032.9155-0.8876QC'd by "Chem Div"
Inactive40 0 0 0 0-4.2306-10.0984-0.7957-0.93222.0609-4.2306QC'd by "Chem Div"
Inactive45.8218-1.6618-3.05539.7773-4.1735.8218QC'd by "Chem Div"
Inactive4-3.265111.605-17.88485.978514.3087-3.2651QC'd by "Chem Div"
Inactive40 0 0 0 0-7.2413.20083.9728-4.51213.9811-7.241QC'd by "Chem Div"
Inactive40 0 0 0 0-9.8078.98690.34840.37287.0197-9.807QC'd by "Chem Div"
Cytotoxic17.782835.5846Partial curve; partial efficacy-4.752.30310.9974-42.6167-7.0321-2.20 0 0 0 0-39.1036-6.2767-6.4175-8.2439-13.6777-39.1036QC'd by "Chem Div"
Cytotoxic3.548140.0619Single point of activity-5.454.95490.8999-40.3659-0.3039-30 0 0 0 12.6367-8.3337.8061-1.7484-40.23322.6367QC'd by "Chem Div"
Inactive40 0 0 0 10.54241.65919.664714.274915.58960.5424QC'd by "Chem Div"
Inactive40 0 0 0 05.9628-8.298-2.31046.1361-3.44285.9628QC'd by "Chem Div"
Inactive40 0 0 0 0-1.0151-4.6247-5.8885-4.492-0.7127-1.0151QC'd by "Chem Div"
Inactive4-0.9022-1.288913.9053-1.0794.3101-0.9022QC'd by "Chem Div"
Inactive40 0 0 0 0-23.5202-1.57517.1469-12.67219.6037-23.5202QC'd by "Chem Div"
Inactive40 0 0 0 1-0.075-0.6173-0.87325.1352.1913-0.075QC'd by "Chem Div"
Cytotoxic35.481333.3813Single point of activity-4.454.95490.4913-37.3813-4-30 0 0 0 0-30.3178-0.6381-23.6633-3.83866.0591-30.3178QC'd by "Chem Div"
Inactive40 0 0 0 0-17.4140.1464-4.8771-5.0687-7.6162-17.414QC'd by "Chem Div"
Inactive4-4.6673-7.1501-3.3264-4.1232-3.249-4.6673QC'd by "Chem Div"
Inactive40 0 0 0 0-17.38786.57262.9374-7.8375-3.1433-17.3878QC'd by "Chem Div"
Inactive40 0 0 0 1-10.2269-7.0609-5.5812-5.82172.0518-10.2269QC'd by "Chem Div"
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:corticotropin-releasing hormone receptor 2 [Homo sapiens]
External ID: SBCCG-A701-CRF-Agonist-Primary-Assay
Protocol: CRF-R2-BP Assay HTS Protocol:
A. Brief Description of the Assay:
This assay identifies modulators of CRF-binding protein and CRF-R2 receptor interaction
B. Materials:
Description, Source, Cat #
CRF-R2.BP HEK293 cells, Assay Provider, N/A
Dulbecco's Phosphate Buffered Saline (DPBS) (1X) without Calcium, Magnesium, Fisher, SH3002802
Probenecid, Sigma, P8761
Bovine Serum Albumin, Fraction V, Sigma, A7888
FLIPR Calcium 4 Dye, Molecular Devices, R8141
Dulbecco's Modified Eagle Medium (DMEM) (1X), Invitrogen, 11965-092
Dulbecco's Modified Eagle Medium (DMEM) (1X), phenol red free, Invitrogen, 31053
Corticotropin Releasing Factor human, rat, Polypeptide Group, SC060
Fetal Bovine Serum, Defined, Hyclone, KTL33155
Penicillin Streptomycin solution, Gibco (Invitrogen), 667539
L-glutamine (100X ), Gibco (Invitrogen), 25030
Hygromycin B, Invitrogen, 10687010
Hank's Balanced Salt Solution (HBSS 10X), Invitrogen, 14065-056
HEPES, Sigma, H3375
T225cm2 Flask, Corning, 3293
Reagent Reservoir, VP Scientific, VP 532-ALB
225mL Conical centrifuge tubes, Falcon, 352075
Cell Strainer, BD Falcon, 352340
Compound Source Plate , Corning, 3730
1536-well black clear-bottom Poly-D-Lysine plate, Corning, 3836-PDL
Cell Factory, Corning, 3270
Molecular Grade Water, Cellgro, 46-000-CM

C. Final Assay Conditions:
Reagent, Final Concentration
FLIPR Calcium 4 Dye, 0.5x (According to Manufacturer's Instruction)
Number of Cells, 1500 cells/well
Antagonist Assay: Corticotropin Releasing Factor human, rat (EC80) in neutral control and test wells
Agonist Assay: Corticotropin Releasing Factor human, rat (EC100) in stimulator control wells
Final assay volume, 8 uL/well (Agonist assay), 9 uL (Antagonist assay)
Test compound concentration, 13.25uM (Agonist assay), 11.78uM (Antagonist assay)
Final DMSO concentration, 0.66% (Agonist assay), 0.59% (Antagonist assay)

D. Procedures:
1. Day before the assay, prepare assay plates as described in the "Cell Culture" section. Cell volume is 6 uL/well. Prepare Reagents as described in the "Recipe" section.
2. Prepare the agonist solution. Agonist stimulator control wells have CRF peptide at EC100 concentration. Antagonist neutral control wells have no CRF peptide while antagonist neutral control and test wells have CRF peptide at EC80 concentration.
3. Add 2uL/well of dye to each well of assay Plate using the Multidrop Combi dispenser and incubate for 1 hour at 37 degrees, 5% CO2, 100% relative humidity.
4. On Hamamatsu FDSS7000, read the baseline for 9 seconds before adding compound. At 10 seconds, add test compound using the pin tool.

E. Plate Format:
Agonist assay, neutral control wells in columns 3 and 4, stimulator control wells in the half bottom of columns 5 and 6 (measured and transferred from antagonist assay), test wells in columns 5-48.
Antagonist assay, neutral control wells in columns 3 and 4, stimulator control wells in the half bottom of columns 5 and 6, test wells in columns 5-48.

F. Cell Culture:
Cell-Maintenance
1. When cells are ~70-80 % confluent in T-225 flask, aspirate media (very slowly) and wash cells with 5mL PBS without calcium or magnesium.
2. Aspirate PBS and add another 10mL PBS (no magnesium or calcium) and let the flask sit for 5 minutes in incubator.
3. Tap flask a few times to remove all cells off of the surface.
4. Add 10mL of Growth Media and wash any remaining cells off the surface of the flask and transfer all 20mL to a 50mL conical tube.
5. Spin down cells at 1200rpm for 4 min in a centrifuge.
6. Aspirate the supernatant and re-suspend the pellet in 10mL of growth media.
7. Split cells 1:5 for a week/weekend split or 1:2 for 2-3 days.
Cell Factory and Cell Seeding
8. Detach 2.5 flasks of cells to seed a 10 Chamber cell stack (see detaching instructions above).
9. Incubate cell factory 3 days at 37 degrees, 5% CO2, 100% relative humidity.
10. Detach cells from the cell factory by first incubating with 100mL DPBS for 5 minutes, rapping on the side of the chamber, and collecting the cells in a 225 mL conical tube. Repeat with 50mLs of additional DPBS.
11. Centrifuge at 1200rpm for 4 minutes, aspirate the supernatant off carefully and re-suspend in assay media.
12. Filter through a cell strainer to remove as many clumps as possible.
13. Count on the cellometer and re-suspend at 1500 cells per 6uL (i.e. 2.5 X 10;5 cells per mL) in assay media.
14. Dispense 6uL per well using the Multidrop Combi.
15. Spin plates down at 500rpm for 1 min in a centrifuge.
16. Cover plates with Kalypsis lids, and incubate plates overnight at 37 degrees, 5% CO2, 100% relative humidity.

G. Recipe:
Assay buffer
1x Hanks Balanced Salt Solution, 20mM HEPES, 0.71 mg/mL probenecid*, 0.1% Bovine Serum Albumin, pH7.4
*Do not add probenecid until after dye is diluted/made up. Add fresh probenecid to the amount of dye that will be used for the assay. Any buffer/dye with probenecid cannot be reused. Buffer without probenecid can be stored for up to 1 week
FLIPR Calcium dye
1. Dilute 1 vial FLIPR Calcium dye vial in 198 mL assay buffer (without probenecid) and re-suspend well. Note: Calculate the amount of dye needed for assay run and then add probenecid relative to the amount of dye. Freeze the remaining dye at -20 degrees.
2. Mix 1 part of 71 mg/mL probenecid in 1N NaOH to 99 parts of the dye solution.
3. pH Dye to 7.4.
CRF Agonist Solution
1. Prepare 1mM stock solution in molecular grade water.
2. Dilute the stock solution with assay buffer to achieve 9x EC80 and EC100 respectively.
Growth Media
DMEM, 10% Fetal Bovine Serum, 1x Penicillin Streptomycin, 1x L-Glutamine, 200ug/mL Hygromycin B
Assay Media
DMEM without Phenol Red, 10% Fetal Bovine Serum, 1x Penicillin Streptomycin, 1x L-Glutamine

H. Instrument setting:
Hamamatsu FDSS700 Settings
Method Type: Fluo4 / FMP
Microplate Format: 1536wells
Camera Exposure: Normal Expo.
Camera Binning 2x2 (for 1536)
Tip & Head Combination: 1 Pin Tool + 1 Tip 1 Head
Sample Interval: 1 sec.
Total Samples: 433
Wavelength: 1Ex1Em (Ex480:Em540)
Data Output: Integ. Ratio, Max Ratio

I. Genedata Pattern Correction:
The experimental values were normalized by difference between values from neutral and stimulator control wells in each plates. Then normalized data was corrected to remove systematic plate patterns due to artifacts such as dispensing and edge effect due to overnight incubation. The algorithm "Assay Pattern (Additive)" was applied in Genedata Screener(R) software to correct screen data. Further information about data correction is available at http://www.genedata.com/products/screener.html.
Comment: Compounds with >=50% Activity at 13.25 uM and <250% Integration_Ratio using Genedata pattern corrected data are defined as actives in the assay.

To simplify the distinction between the inactives of the primary screen and of the confirmatory screening stage, the Tiered Activity Scoring System was developed and implemented.

Activity scoring rules were devised to take into consideration compound efficacy, its potential interference with the assay and the screening stage that the data was obtained. Details of the Scoring System will be published elsewhere. Briefly, the outline of the scoring system utilized for the assay is as follows:
1) First tier (0-40 range) is reserved for primary screening data and is not applicable in this assay.

1) First tier (0-40 range) is reserved for primary screening data. The score is correlated with % activity in the assay:
a. If outcome of the primary screen is inactive, then the assigned score is 0
b. If outcome of the primary screen is inconclusive, then the assigned score is 10
c. If outcome of the primary screen is active, then the assigned score is 20
Scoring for Single concentration confirmation screening is not applicable to this assay.
d. If outcome of the single-concentration confirmation screen is inactive, then the assigned score is 21
e. If outcome of the single-concentration confirmation screen is inconclusive, then the assigned score is 25
f. If outcome of the single-concentration confirmation screen is active, then the assigned score is 30
This scoring system helps track the stage of the testing of a particular SID. For the primary hits which are available for confirmation, their scores will be greater than 20. For those which are not further confirmed, their score will stay under 21.
2) Second tier (41-80 range) is reserved for dose-response confirmation data and is not applicable in this assay.
3) Third tier (81-100 range) is reserved for resynthesized true positives and their analogues and is not applicable in this assay.
%Activity at 13.25 uMValueIntegration_RatioMean LowStd Deviation LowMean HighStd Deviation High
0.281.0110.46491.780.081.010.01
1.781.0253.2541.780.081.010.01
-0.41.009-0.8081.780.081.010.01
0.11.0060.84051.780.081.010.01
-0.211.007-2.2481.780.081.010.01
-1.271-4.771.780.081.010.01
-0.071.0133.1351.780.081.010.01
1.141.0170.95041.780.081.010.01
-0.111.0070.82171.780.081.010.01
-0.161.0060.66711.780.081.010.01
-0.151.007-4.4291.780.081.010.01
16.891.1386.3541.780.081.010.01
0.141.009-0.067121.780.081.010.01
-0.011.009-0.92481.780.081.010.01
-0.081.0111.8191.780.081.010.01
0.931.0174.5471.780.081.010.01
0.571.016-1.1731.780.081.010.01
0.551.015-1.0721.780.081.010.01
1.561.026-0.86931.780.081.010.01
-1.5511.9941.780.081.010.01
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:corticotropin-releasing hormone receptor 2 [Homo sapiens]
External ID: SBCCG-A702-CRF-Antagonist-Primary-Assay
Protocol: A. Brief Description of the Assay:
This assay identifies modulators of CRF-binding protein and CRF-R2 receptor interaction
B. Materials:
Description, Source, Cat #
CRF-R2.BP HEK293 cells, Assay Provider, N/A
Dulbecco's Phosphate Buffered Saline (DPBS) (1X) without Calcium, Magnesium, Fisher, SH3002802
Probenecid, Sigma, P8761
Bovine Serum Albumin, Fraction V, Sigma, A7888
FLIPR Calcium 4 Dye, Molecular Devices, R8141
Dulbecco's Modified Eagle Medium (DMEM) (1X), Invitrogen, 11965-092
Dulbecco's Modified Eagle Medium (DMEM) (1X), phenol red free, Invitrogen, 31053
Corticotropin Releasing Factor human, rat, Polypeptide Group, SC060
Fetal Bovine Serum, Defined, Hyclone, KTL33155
Penicillin Streptomycin solution, Gibco (Invitrogen), 667539
L-glutamine (100X ), Gibco (Invitrogen), 25030
Hygromycin B, Invitrogen, 10687010
Hank's Balanced Salt Solution (HBSS 10X), Invitrogen, 14065-056
HEPES, Sigma, H3375
T225cm2 Flask, Corning, 3293
Reagent Reservoir, VP Scientific, VP 532-ALB
225mL Conical centrifuge tubes, Falcon, 352075
Cell Strainer, BD Falcon, 352340
Compound Source Plate , Corning, 3730
1536-well black clear-bottom Poly-D-Lysine plate, Corning, 3836-PDL
Cell Factory, Corning, 3270
Molecular Grade Water, Cellgro, 46-000-CM

C. Final Assay Conditions:
Reagent, Final Concentration
FLIPR Calcium 4 Dye, 0.5x (According to Manufacturer's Instruction)
Number of Cells, 1500 cells/well
Antagonist Assay: Corticotropin Releasing Factor human, rat (EC80) in neutral control and test wells
Agonist Assay: Corticotropin Releasing Factor human, rat (EC100) in stimulator control wells
Final assay volume, 8 uL/well (Agonist assay), 9 uL (Antagonist assay)
Test compound concentration, 13.25uM (Agonist assay), 11.78uM (Antagonist assay)
Final DMSO concentration, 0.66% (Agonist assay), 0.59% (Antagonist assay)

D. Procedures:
1. Day before the assay, prepare assay plates as described in the "Cell Culture" section. Cell volume is 6 uL/well. Prepare Reagents as described in the "Recipe" section.
2. Prepare the agonist solution. Agonist stimulator control wells have CRF peptide at EC100 concentration. Antagonist neutral control wells have no CRF peptide while antagonist neutral control and test wells have CRF peptide at EC80 concentration.
3. Add 2uL/well of dye to each well of assay Plate using the Multidrop Combi dispenser and incubate for 1 hour at 37 degrees, 5% CO2, 100% relative humidity.
4. On Hamamatsu FDSS7000, read the baseline for 9 seconds before adding compound. At 10 seconds, add test compound using the pin tool. At 243 seconds, add the agonist using the tips.

E. Plate Format:
Agonist assay, neutral control wells in columns 3 and 4, stimulator control wells in the half bottom of columns 5 and 6 (measured and transferred from antagonist assay), test wells in columns 5-48.
Antagonist assay, neutral control wells in columns 3 and 4, stimulator control wells in the half bottom of columns 5 and 6, test wells in columns 5-48.

F. Cell Culture:
Cell-Maintenance
1. When cells are ~70-80 % confluent in T-225 flask, aspirate media (very slowly) and wash cells with 5mL PBS without calcium or magnesium.
2. Aspirate PBS and add another 10mL PBS (no magnesium or calcium) and let the flask sit for 5 minutes in incubator.
3. Tap flask a few times to remove all cells off of the surface.
4. Add 10mL of Growth Media and wash any remaining cells off the surface of the flask and transfer all 20mL to a 50mL conical tube.
5. Spin down cells at 1200rpm for 4 min in a centrifuge.
6. Aspirate the supernatant and re-suspend the pellet in 10mL of growth media.
7. Split cells 1:5 for a week/weekend split or 1:2 for 2-3 days.
Cell Factory and Cell Seeding
8. Detach 2.5 flasks of cells to seed a 10 Chamber cell stack (see detaching instructions above).
9. Incubate cell factory 3 days at 37 degrees, 5% CO2, 100% relative humidity.
10. Detach cells from the cell factory by first incubating with 100mL DPBS for 5 minutes, rapping on the side of the chamber, and collecting the cells in a 225 mL conical tube. Repeat with 50mLs of additional DPBS.
11. Centrifuge at 1200rpm for 4 minutes, aspirate the supernatant off carefully and re-suspend in assay media.
12. Filter through a cell strainer to remove as many clumps as possible.
13. Count on the cellometer and re-suspend at 1500 cells per 6uL (i.e. 2.5 X 10;5 cells per mL) in assay media.
14. Dispense 6uL per well using the Multidrop Combi.
15. Spin plates down at 500rpm for 1 min in a centrifuge.
16. Cover plates with Kalypsis lids, and incubate plates overnight at 37 degrees, 5% CO2, 100% relative humidity.

G. Recipe:
Assay buffer
1x Hanks Balanced Salt Solution, 20mM HEPES, 0.71 mg/mL probenecid*, 0.1% Bovine Serum Albumin, pH7.4
*Do not add probenecid until after dye is diluted/made up. Add fresh probenecid to the amount of dye that will be used for the assay. Any buffer/dye with probenecid cannot be reused. Buffer without probenecid can be stored for up to 1 week
FLIPR Calcium dye
1. Dilute 1 vial FLIPR Calcium dye vial in 198 mL assay buffer (without probenecid) and re-suspend well. Note: Calculate the amount of dye needed for assay run and then add probenecid relative to the amount of dye. Freeze the remaining dye at -20 degrees.
2. Mix 1 part of 71 mg/mL probenecid in 1N NaOH to 99 parts of the dye solution.
3. pH Dye to 7.4.
CRF Agonist Solution
1. Prepare 1mM stock solution in molecular grade water.
2. Dilute the stock solution with assay buffer to achieve 9x EC80 and EC100 respectively.
Growth Media
DMEM, 10% Fetal Bovine Serum, 1x Penicillin Streptomycin, 1x L-Glutamine, 200ug/mL Hygromycin B
Assay Media
DMEM without Phenol Red, 10% Fetal Bovine Serum, 1x Penicillin Streptomycin, 1x L-Glutamine

H. Instrument setting:
Hamamatsu FDSS700 Settings
Method Type: Fluo4 / FMP
Microplate Format: 1536wells
Camera Exposure: Normal Expo.
Camera Binning 2x2 (for 1536)
Tip & Head Combination: 1 Pin Tool + 1 Tip 1 Head
Sample Interval: 1 sec.
Total Samples: 433
Wavelength: 1Ex1Em (Ex480:Em540)
Data Output: Integ. Ratio, Max Ratio

I. Genedata Pattern Correction:
The experimental values were normalized by difference between values from neutral and stimulator control wells in each plates. Then normalized data was corrected to remove systematic plate patterns due to artifacts such as dispensing and edge effect due to overnight incubation. The algorithm "Assay Pattern (Additive)" was applied in Genedata Screener(R) software to correct screen data. Further information about data correction is available at http://www.genedata.com/products/screener.html.
Comment: Compounds that demonstrated >= 50% inhibition at 11.78 uM, as measured by the maximum fluorescence ratio, relative to the ligand control are defined as antagonists of the CRF-R2-CRF-BP complex.

To simplify the distinction between the inactives of the primary screen and of the confirmatory screening stage, the Tiered Activity Scoring System was developed and implemented.

Activity scoring rules were devised to take into consideration compound efficacy, its potential interference with the assay and the screening stage that the data was obtained. Details of the Scoring System will be published elsewhere. Briefly, the outline of the scoring system utilized for the assay is as follows:

1) First tier (0-40 range) is reserved for primary screening data. The score is correlated with % activity in the assay:
a. If outcome of the primary screen is inactive, then the assigned score is 0
b. If outcome of the primary screen is inconclusive, then the assigned score is 10
c. If outcome of the primary screen is active, then the assigned score is 20
Scoring for Single concentration confirmation screening is not applicable to this assay.
d. If outcome of the single-concentration confirmation screen is inactive, then the assigned score is 21
e. If outcome of the single-concentration confirmation screen is inconclusive, then the assigned score is 25
f. If outcome of the single-concentration confirmation screen is active, then the assigned score is 30
This scoring system helps track the stage of the testing of a particular SID. For the primary hits which are available for confirmation, their scores will be greater than 20. For those which are not further confirmed, their score will stay under 21.

2) Second tier (41-80 range) is reserved for dose-response confirmation data and is not applicable in this assay.

3) Third tier (81-100 range) is reserved for resynthesized true positives and their analogues and is not applicable in this assay.
%Inhibition at 11.78 uMValueMean LowStd Deviation LowMean HighStd Deviation High
-33.021.9961.090.021.670.12
-1.491.8041.090.021.670.12
13.681.6381.090.021.670.12
-7.321.8411.090.021.670.12
23.031.5711.090.021.670.12
-15.61.8721.090.021.670.12
10.781.6421.090.021.670.12
14.351.7191.090.021.670.12
12.161.6461.090.021.670.12
-13.041.7761.090.021.670.12
6.361.6871.090.021.670.12
-2.111.7681.090.021.670.12
7.681.8061.090.021.670.12
-9.141.8171.090.021.670.12
-18.41.6981.090.021.670.12
4.611.651.090.021.670.12
22.481.5841.090.021.670.12
-10.211.881.090.021.670.12
0.691.7921.090.021.670.12
-13.411.8591.090.021.670.12
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:HNF4 Alpha
External ID: BHood-p-21Jun2013-01
Protocol: This assay is to identify inhibitors of HNF4 alpha protein binding to DNA
##

A. Materials:##
Description#Company#Cat #
1M TRIS #BioRad#161-0719
DTT#RPI#D11000
Glycerol#Amersco #0854-1L
NaCL#Fisher Bioreagents#BP358-212
Tween 20#Sigma#P1379
HNF4 Protein #Assay Provider#
FITC-DNA#Assay Provider#
1536 well black high base plate#Aurora#00019120BX
##
B. Plate Map:##
Positive control in columns 1 and 2 is DNA and 70nM Protein##
Negative control in columns 3 and 4, Protein at 650nM and DNA, DMSO##
Test compound in columns 5 - 48, Protein at 70nM + DNA + test compound

C. Procedures:##########
Step#Description#########
1#Transfer test compounds to columns 5-48, DMSO to columns 1-4 using ECHO 555.#########
2#Set up Envision as as described in G. Instrument setting.#########
3#Prepare assay buffer.#########
4#Dispense undiluted HNF4 protein solution at into col 3-4 and 140nM HNF4 protein into columns 1,2, and 5-48. #########
5#Dispense 3uL/well of FITC-DNA (FAC = 5nM) using BioRAPTR#########
6#Spin down plates on Eppendorf centrifuge 5810 at 1000 rpm for 1 minute.#########
7#Incubate plates at RT for 1 hour.#########
8#Read using FP protocol on Envision#########
##########
D. Assay Conditions:##########
Reagent##Final Conc.#Unit#######
1#Tris pH7.4#0.02#M#######
2#NaCl#0.05#M#######
3#DTT#0.01#M#######
4#Glycerol#10#%#######
5#Protein#650 for EC100 and 70nM for EC20#uM#######
6#DNA#5#nM#######
*#6uL reaction volume#########
*#60 min reaction at room temp#########
*#10uM test compound#########
*#0.5% DMSO
Comment:
%Activity_Corrected at 10 uMValue at 10 uMMean HighSTD Deviation HighMean LowSTD Deviation Low
-6.39105.0999985116.057.38199.696.53
-0.54109.8000031116.057.38199.696.53
-0.14111.9000015116.057.38199.696.53
3.17114.4000015116.057.38199.696.53
0.67110.0999985116.057.38199.696.53
-1.92108.3000031116.057.38199.696.53
-1.35108.0999985116.057.38199.696.53
1.56110.5999985116.057.38199.696.53
1.88112.1999969116.057.38199.696.53
1.69111.5999985116.057.38199.696.53
-0.73109.9000015116.057.38199.696.53
-0.36111.1999969116.057.38199.696.53
9.41119.5999985116.057.38199.696.53
-0.85109.3000031116.057.38199.696.53
-0.03110.0999985116.057.38199.696.53
2.36112116.057.38199.696.53
3.01113.1999969116.057.38199.696.53
-0.42109.0999985116.057.38199.696.53
-1.98107.5999985116.057.38199.696.53
0.83108.9000015116.057.38199.696.53
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:tyrosyl-DNA phosphodiesterase 2 [Homo sapiens]
External ID: TPD2_INH_EPIABS_1536_1X%INH PRUN
Protocol: Assay Overview:

The purpose of this assay is to identify compounds that act as inhibitors of the activity of tyrosyl DNA phosphodiesterase 2 (TDP2). TDP2 is a divalent cation-dependent enzyme that repairs TopII-associated DNA strand breaks. It is hypothesized that inhibitors of TDP2 may serve as useful adjuvants in combination with cancer drugs such as etoposide.

In this biochemical assay, recombinant human TDP2 protein is incubated at 37 degrees Celsius with the T5PNP substrate in the presence of Mg2+-containing assay buffer.T5PNP is a substrate for snake venom phosphodiesterase, as well as a substrate for TDP2. As a substrate for TDP2, T5PNP is used to mimic the TopII-DNA complex. TDP2 cleaves the phosphodiester bond in T5PNP, and the chromogenic p-nitrophenol group is released. As time increases the TDP2 enzyme will increasingly catalyze hydrolysis of the T5PNP substrate, resulting in increased release of p-nitrophenol and detection at 415nM wavelength. Compounds are tested in singlicate at a final nominal concentration of 12.8microM.

Protocol Summary:

Prior to the start of the assay, 2 ul of a solution containing T5PNP subtrate (final concentration 5mM) in assay buffer (50mM Tris-HCl pH7.5, 1mM DTT, 1mM MgCl2, 50mM KCl and 100ug/ml BSA) was dispended into a all wells of a 1536 well plate. Next, 39nL of test compound in DMSO or DMSO alone (1% final concentration) was added to the appropriate wells. The assay was started by dispensing 1 ul of a solution contanting TDP2 enzyme (120nM final concentration) in assay buffer to wells in columns 4-48 and 1ul of assay buffer alone to wells in columnes 1-3. Plates were centrifuged and incubated for 2hrs at 37 degrees Celsius at which time fluorescence intensity was measured (Ex. 405nm and Em. 405nm) using a EnVision microplate reader (Perkin Elmer).

Prior to further calculations, the following formula was used to calculate Epi Absorbance (EPIABS)

EPIABS = -log10( sample / background)

Where:

Sample is defined as the fluorescent intensity of wells containing test compounds or DMSO.
Background is defined as the fluorescent intensity of wells containing buffer and T5PNP only.

The % inhibition for each well was then calculated as follows:

%_Inhibition = ( EPIABS_Test_Compound - MedianEPIABS_Low_Control ) / ( MedianEPIABS_High_Control - MedianEPIABS_Low_Control ) * 100

Where:

Test_Compound is defined as wells containing test compound, TDP2 and T5PNP.
High_Control is defined as wells containing only Buffer and T5PNP.
Low_Control is defined as wells containing DMSO, TDP2 and T5PNP.

A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Two values were calculated: (1) the average percent inhibition of all compounds tested, and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter, i.e. any compound that exhibited greater % inhibition than the cutoff parameter was declared active.

PubChem Activity Outcome and Score:

The reported PubChem Activity Score has been normalized to 100% observed primary inhibition. Negative % inhibition values are reported as activity score zero.

The PubChem Activity Score range for active compounds is 100-22, and for inactive compounds 22-0.

List of Reagents:

TDP2 (supplied by Assay Provider)
Tris Base(Sigma, 93349)
DTT (Sigma, 43815)
BSA (Sigma, A2153)
MgCl2 (Sigma,M2670)
KCl (Sigma, P9333)
T5PNP (Sigma, T4510)
1536 well plates (Corning 7254)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. In this case the results of each separate campaign were assigned "Active/Inactive" status based upon that campaign's specific compound activity cutoff value. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Inhibition at 12.8 uM
9.44
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
9.43
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:ICCB-Longwood/NSRB Screening Facility, Harvard Medical School 靶标:ubiquitin C-terminal hydrolase UCH37 [Homo sapiens]
External ID: HMS937_MLP
Protocol: 10 microL of proteasome-containing buffer (0.15 nM proteasome in 50 mM Tris-HCl, pH 7.4, 1 mg/ml ovalbumin, 1 mM ATP-MgCl2, 1mM DTT) were added to each well of 384-well plates (Corning 3820), except for column 1, which was used for positive controls.

100 nL of each experimental compound were transferred to the assay plates by pin transfer, and then incubated for 30 minutes at room temperature.

10 microL of 1 microM Ub-AMC in buffer (50 mM Tris-HCl, pH 7.4, 1 mg/ml ovalbumin, 1 mM ATP-MgCl2, 1mM DTT) were added to all wells of the assay plates, and then incubated for 25 minutes at room temperature. The fluorescence intensity of each well was then read using a Perkin Elmer EnVision plate reader at 355 nm/460 nm (excitation/emission).

For positive controls, 10 microL of 1 microM Ub-AMC in buffer (50 mM Tris-HCl, pH 7.4, 1 mg/ml ovalbumin, 1 mM ATP-MgCl2, 1mM DTT) were added to all wells in column 1 on each assay plate, and incubated for 25 minutes at room temperature before fluorescence reading.

For negative controls, 10 microL of proteasome-containing buffer (0.15 nM proteasome in 50 mM Tris-HCl, pH 7.4, 1 mg/ml ovalbumin, 1 mM ATP-MgCl2, 1mM DTT) were added to all wells in column 2 on each assay plate, and then 10 microL of 1 microM Ub-AMC in buffer (50 mM Tris-HCl, pH 7.4, 1 mg/ml ovalbumin, 1 mM ATP-MgCl2, 1mM DTT) was added. After incubation at room temperature for 25 minutes, fluorescence intensity was read.
Comment: Activity scores were calculated based on percent (%) inhibition, which was in turn calculated from fluorescence intensity (FI) readings as follows: % Inhibition = (1-((Vi-Vp)/(Vn-Vp)))*100, where Vi is the FI of the individual well, Vp the average FI of the positive controls on that plate, and Vn the average FI of the negative controls on that plate. A final % inhibition value was calculated as the average of replicate results for each individual compound and used to determine the Activity Score. If the % inhibition was less than zero, the Activity Score was set to Zero. Compounds showing >20% inhibition were considered active.
Intensity_AIntensity_B% Inhibition_A% Inhibition_B% Inhibition_Avg
178098917969040.074078071-0.350762612-0.13834227
172000717391253.6655743723.0325207123.349047542
173729017567722.6477030241.9991902492.323446637
18811361944688-5.824016122-9.004341641-7.414178881
168054517109575.9896638914.6819145175.335789204
170653317333914.4591170763.3682784543.913697765
171496017164903.9628142444.3579264494.160370346
23179082330801-31.54742668-31.61341542-31.58042105
18180321815841-2.107545973-1.459629783-1.783587878
175204217682761.7788933191.3255667641.552230042
20798802137189-17.52891824-20.2763509-18.90263457
18312141846147-2.883891522-3.234215435-3.059053479
1121625611453427-555.6100014-565.7941457-560.7020735
17948731798387-0.743611323-0.437600549-0.590605936
76735987884914-346.9674002-356.8377684-351.9025843
17999161811790-1.040615617-1.222421096-1.131518356
170978517398484.2675925942.9901850223.628888808
170530317191164.5315571484.2041594744.367858311
172075917331433.6212858083.382800243.502043024
169800217124654.9615449234.5936126914.777578807
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:Phospholipase C, gamma 1 [Homo sapiens]
External ID: PLCG1_INH_QFRET_1536_1X%INH PRUN
Protocol: Assay Overview:

The purpose of this biochemical assay is to identify compounds that act as inhibitors of the activity of phospholipase C isozymes, PLC-G1. In this assay, PLC-G1 isozyme is incubated with test compounds and fluorogenic reporter WH-15. As designed, test compounds that act as PLC-G1 inhibitors will prevent the hydrolysis of WH-15 fluorogenic reporter, thus preventing the release of IP3, a quinomethide derivative, and 6-aminoquinoline, which is highly fluorescent, leading to decreasing well fluorescence. Compounds are tested in singlicate at a nominal test concentration of 12.2 micromolar.

Protocol Summary:

Prior to the start of the assay, 2 microliters of PLC-G1 at a final concentration of 5pg/ul (in 50 mM HEPES pH 7.2, 70 mM KCl, 3mM CaCL2, 3mM EGTA, 2mM DTT, 0.04mg/mL acid-free BSA, with Cholate 0.5%) are dispensed into 1536 microtiter plates, 1 microliter of assay buffer is dispensed into columns 4-48 and 1 microliter of 0.2M EGTA is added to columns 1-3. Compounds are added to plate (final concentration 12.2uM) and incubated for 10 minutes at 25 degrees Celsius. The assay start by the addition of 2 microliter of WH-15 fluorogenic reporter at a final concentration 10uM in Assay Buffer to all wells. Plates were centrifuged and after 90 min of incubation at 25 degrees Celsius fluorescence is measured at 355nm excitation and 535nm emmision.

The percent inhibition for each compound was calculated as follows:

100 *( ( Test_Compound - Median_Low_Control ) / ( Median_High_Control - Median_Low_Control ) )

Where:

Test_Compound is defined as wells containing PLCG1 in the presence of test compound and WH15 fluoreogenic reporter.
High_Control is defined as wells containing PLCG1, WH15 fluoreogenic reporter and EGTA.
Low_Control is defined as the median of the wells containing test compounds.

A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Four values were calculated: (1) the average percent inhibition of all high controls tested plus three times the standard deviation of the high controls, (2) the average percent inhibition of all low controls tested minus three times the standard deviation of the low controls, (3) the average percent inhibition of all compounds tested between (1) and (2), and (4) three times their standard deviation. The sum of two of these values, (3) and (4), was used as a cutoff parameter, i.e. any compound that exhibited greater % inhibition/activity than the cutoff parameter was declared active.

PubChem Activity Outcome and Score:

The reported PubChem Activity Score has been normalized to 100% observed primary inhibition. Negative % inhibition values are reported as activity score zero.

The activity score range for active compounds is 100-11, for inactive 11-0.

List of Reagents:

PLCG1 isozyme (Supplied by Assay Provider)
WH-15 fluorogenic reporter (Supplied by KXTBio)
HEPES (Fisher, BP310)
Sodium cholate hydrate (Sigma, C6445)
CaCl2 (Sigma, 06991)
EGTA (Fisher, O2783)
DTT (Fisher, BP172)
KCl (Sigma, P9541)
1536-well plates (Corning, part 7261)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Inhibition at 12.2 uM
4.43
4.43
4.43
4.43
4.43
4.43
4.43
4.43
4.43
4.43
4.43
4.43
4.43
4.43
4.43
4.42
4.42
4.42
4.42
4.42
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:cystic fibrosis transmembrane conductance regulator [Homo sapiens]
External ID: SBCCG-A764-CF-PAF-Primary-Assay
Protocol: Assay Materials:
KKLEB-NFkB-GFP cells (Assay Provider)
PAF(Assay Provider)
Fetal Bovine Serum (Hyclone SH30396.03)
Penicillin Streptomycin solution
L-glutamine (100X)
TrypLE (Invitrogen 12563)
DPBS without calcium and magnesium (1X)
Corning culture flasks
Black CellBind 1536-well plates (Corning 3833)
ATPlite (Perkin Elmer 6016739)

I. Cell Suspension
1- Dispense 3 uL/well of cells at 5X10;5 cells/mL to the whole plate (plate cells in 2% FBS assay media).
2- Spin down plates on Eppendorf centrifuge 5810 at 500 rpm for 1 minute.

II. Compound Addition:
3- Transfer test compounds to columns 5-48 and DMSO to columns 1-4 using the Labcyte ECHO 555.
4- Transfer volume of test compound and DMSO is 15nL, making 5uM compound concentration at 0.25% DMSO final.
5-Spin down plates on Vspin at 1000 rpm for 1 minute.
6-Put Kalypsys metal lids on plates, incubate plates at 37 degrees C with 5% CO2 for 2 hours.

III. Reagent Addition
7- Dispense 3 uL/well of serum free assay media to columns 1 and 2.
8- Dispense 3 uL/well of PAF (dilute in serum free assay media) to columns 3-48.
9- Spin down plates without lids on Vspin at 2000 rpm for 2 min
10- Put Kalypsys metal lids on plates, and incubate plates at 37 degrees C with 5% CO2 overnight.

IV. Reading plates:

11-Spin plates upside down with a container at 1000 rpm for 15 sec. Dab them with a tissue to dry them and Read immediately on envision for GFP fluorescence.
12-Dispense 6 uL/well of ATPlite (diluted in DPBS 1:1).
13-Spin down plates on Eppendorf centrifuge 5810 at 2000 rpm for 2 minutes without lids.
14-Incubate plates for 10 min at RT and run Luminescence read on Viewlux.
Comment: Compounds that demonstrated a corrected %Activity of >= 50% at 5 uM concentration are defined as actives in this assay.

The experimental values were normalized by the difference between values from neutral and stimulator control wells in each plate. Then normalized data was corrected to remove systematic plate patterns due to artifacts such as dispensing tip issues etc. Further information about data correction is available at http://www.genedata.com/products/screener.html.

To simplify the distinction between the inactives of the primary screen and of the confirmatory screening stage, the Tiered Activity Scoring System was developed and implemented. Its utilization for the assay is described below.

Activity Scoring
Activity scoring rules were devised to take into consideration compound efficacy, its potential interference with the assay and the screening stage that the data was obtained. Details of the Scoring System will be published elsewhere. Briefly, the outline of the scoring system utilized for the assay is as follows:
1) First tier (0-40 range) is reserved for primary and single-concentration confirmation screening data.
a. If outcome of the primary screen is inactive, then the assigned score is 0
b. If outcome of the primary screen is inconclusive, then the assigned score is 10
c. If outcome of the primary screen is active, then the assigned score is 20
d. If outcome of the single-concentration confirmation screen is inactive, then the assigned score is 21
e. If outcome of the single-concentration confirmation screen is inconclusive, then the assigned score is 25
f. If outcome of the single-concentration confirmation screen is active, then the assigned score is 30.
This scoring system helps track the stage of the testing of a particular SID. For the primary hits which are available for confirmation, their scores will be greater than 20. For those which are not further confirmed, their score will stay under 21.

2) Second tier (41-80 range) is reserved for dose-response confirmation data and is not applicable in this assay

3) Third tier (81-100 range) is reserved for resynthesized true positives and their analogues and is not applicable in this assay
%Activity at 5 uMValueMean LowStd Deviation LowMean High Std Deviation High
17.71388986164067.888625.22080144.63200104.91
-5.52023753164067.888625.22080144.63200104.91
-1.91947331164067.888625.22080144.63200104.91
4.91776516164067.888625.22080144.63200104.91
4.41681435164067.888625.22080144.63200104.91
7.11654104164067.888625.22080144.63200104.91
-16.92220014164067.888625.22080144.63200104.91
5.51825441164067.888625.22080144.63200104.91
-10.22135725164067.888625.22080144.63200104.91
13.11722580164067.888625.22080144.63200104.91
0.11996001164067.888625.22080144.63200104.91
-1.51994666164067.888625.22080144.63200104.91
12.61687553164067.888625.22080144.63200104.91
-12.42138337164067.888625.22080144.63200104.91
1.91864558164067.888625.22080144.63200104.91
14.31574274164067.888625.22080144.63200104.91
20.41414289164067.888625.22080144.63200104.91
67.4531762164067.888625.22080144.63200104.91
3.11778225164067.888625.22080144.63200104.91
53.5823431164067.888625.22080144.63200104.91
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:muscarinic acetylcholine receptor M1 [Homo sapiens]
External ID: CHRM1_ANT_FLUO8_1536_1X%INH PRUN
Protocol: Assay Overview:

The purpose of this assay is to identify compounds that act as antagonists and decrease activity of the human M1 muscarinic receptor (CHRM1; M1) that have been pre-treated with a known agonist, with the end result being a decrease in intracellular calcium. In this assay, CHO-K1 cells stably expressing human M1 are loaded with the Fluo-8 calcium indicator dye. Compounds are added followed by treatment with the activator acetylcholine at a concentration that results in 80% activation (Ec80). As designed, compounds that act as CHRM1 antagonists will decrease calcium mobilization, resulting in decreased relative fluorescence of the indicator dye below that of the Ec80 of acetylcholine. Compounds are tested in singlicate at a final nominal concentration of 3 uM.

Protocol Summary:

The CHO-hM1 cell line was routinely cultured in T-175 sq cm flasks at 37 C and 95% relative humidity (RH). The growth media consisted of Ham's F-12 Nutrient Media (F-12) supplemented with 10% v/v heat-inactivated qualified fetal bovine serum, 20 mM HEPES, 50 ug/mL Geneticin, and 1X antibiotic mix (penicillin and streptomycin).

The day before the assay 3000 cells in 3 uL of growth media were seeded into each well of 1536 well microtiter plates and allowed to incubate at 37 C, 5% CO2, and 95 % RH for 17-24 hours. Next, 2 uL of the fluorogenic Fluo-8 intracellular calcium indicator mixture (prepared according to the manufacturer's protocol) was added to each well. Plates were then incubated for 1 hour at 37 C, 5% CO2, and 95 % RH, followed by 30 minute incubation at room temperature. Then, 15 nL of test compound in DMSO were transferred to appropriate wells. The assay was started by performing a basal read of plate fluorescence (470 - 495 nm excitation and 515 - 575 nm emission) for 5 seconds on the FLIPR Tetra (Molecular Devices) prior to all wells being treated with an EC80 concentration of acetylcholine. Then a real time fluorescence measurement was immediately performed for the remaining 140 seconds of the assay.

Hits for this assay were determined according to the following mathematical expression:

Ratio = I_Max / I_Min

Where:

I_Max represents the maximum measured fluorescence emission intensity over the 140 second read and,
I_Min represents the minimum (basal) measured fluorescence emission intensity before compound was added.

The percent inhibition was calculated from the median ratio as follows:

%_Inhibition = ( 1 - ( Ratio Test_Compound - Median_Ratio_High_Control ) / ( Median_Ratio_Low_Control - Median_Ratio_High_Control ) ) ) * 100

Where:

Test_Compound is defined as wells containing test compound.
Low_Control is defined as wells containing Ec80 of acetylcholine and DMSO.
High_Control is defined as wells containing DMSO.

PubChem Activity Outcome and Score:

A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Two values were calculated for each assay plate: (1) the average percent inhibition of test compound wells and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter for each plate, i.e. any compound that exhibited greater % inhibition than that particular plate's cutoff parameter was declared active.

The reported PubChem Activity Score has been normalized to 100% observed inhibition. Negative % inhibition values are reported as activity score zero.

The PubChem Activity Score range for active compounds is 100-7, and for inactive compounds 80-0.

In this assay not all plates were run in the same batch. This resulted in batch-to-batch variation among the different batches of plates, thereby necessitating the use of a plate-based activity cutoff. For this reason the inactive and active scores overlap.

List of Reagents:

Cell line: Chinese Hamster Ovary (CHO) cells containing hM1 receptor; (Conn Lab)
Calcium sensitive dye: Fluo-8 No Wash Calcium Assay Kit; (AAT Bioquest, part 36316)
Growth media: Ham's F-12; 10% FBS, 20mM HEPES, 50 ug/mL G418
Assay media: Ham's F-12, 10% FBS, 20 mM HEPES
Assay plates: Aurora black/clear 1536well FLIPR plate; (Aurora, part 00019326)
Probenecid: 250mM (pH 8.0); (Sigma P8761)
Potentiator: Acetylcholine (50 mM stock in water); Sigma A9187
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, and compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Inhibition at 3 uM
6.48
6.48
6.48
6.48
6.48
6.48
6.48
6.48
6.48
6.48
6.48
6.48
6.47
6.47
6.47
6.47
6.47
6.47
6.47
6.47
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:ICCB-Longwood/NSRB Screening Facility, Harvard Medical School 靶标:N/A
External ID: HMS1364-MLP_WT
Protocol: The day before screening, RN4220 was grown overnight (16-18 h) in sterile-filtered tryptic soy broth (TSB) at 30 degrees C with shaking.

On the day of screening, columns 1-24 of assay plates (Corning 3710, clear) were prefilled with 30 uL of TSB using the Combi. Next, 100 nL of each compound was pin-transferred to each plate. For every compound library plate, there were two daughter plates (A & B). Overnight cultures were diluted 625x into TSB. 50 uL of the diluted cultures were added to columns 1-24 of the corresponding assay plates. Wells in column 2 contained only medium (with culture) and served as the negative controls. Positive control (0.8 uL of erythromycin, 10 ug/mL) was added to column 1 using the Hewlett Packard D300. Final assay well volume was 80 uL. Plates were spun down and stacked 5 high, covered with lids (Corning 3009), and incubated at 30 degrees C overnight (~16 h).

The following day, assay plates were removed from the incubator and cell density quantitated using a PerkinElmer EnVision (600 nm filter).
Comment: Z-scores were calculated for every well based on plate average and standard deviation of experimental well absorbance (OD600). Wells were considered active for reduced WT survival if Z-score for both replicates <= -3 and absorbance for both replicates <= 0.18. Percent inhibition was calculated by subtracting well absorbance from negative control plate average absorbance, dividing by the difference between plate negative and positive control plate average absorbance, and multiplying by 100. The replicate values were then averaged to determine activity scores. Resulting values > 100 were set to 100 and < 0 were set to 0, where 100 = 100% activity.
Absorbance_WT_AAbsorbance_WT_BZ-score WT_AZ-score WT_BPercent Inhibition_WT_APercent Inhibition_WT_B
0.7370.747-1.624235685-1.0789525314.234071413.85068762
0.7480.834-1.4382629330.33116364814.991762772.84634982
0.8350.8340.0326124740.3311636482.922049772.84634982
0.7920.828-0.6943719230.2339142568.8875401023.68971273
0.9390.8961.7909003161.336074027-11.50611289-5.868400246
0.8210.844-0.204080120.4932459674.8643024361.440744971
0.8110.872-0.3731462590.9470764616.25162577-2.494948608
0.8230.872-0.1702668930.9470764614.58683777-2.494948608
0.7990.862-0.5760256250.7849941427.916413769-1.089343758
0.8480.8940.2523984541.3036575631.118529437-5.587279276
0.8410.8920.1340521571.2712410992.08965577-5.306158306
0.8660.8620.5567175040.784994142-1.378652562-1.089343758
0.8760.8650.7257836430.833618837-2.765975895-1.511025213
0.8370.8680.0664257020.8822435332.644585104-1.932706668
0.8380.8630.0833323160.8012023732.50585277-1.229904243
0.8120.844-0.3562396450.4932459676.1128934361.440744971
0.8150.877-0.3055198041.028117625.696696436-3.197751032
0.8650.8950.539810891.319865795-1.239920229-5.727839761
0.8310.88-0.0350139821.0767423163.476979103-3.619432487
0.8440.8450.1847719990.5094541991.673458771.300184486
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:fructose-bisphosphate aldolase [Mycobacterium tuberculosis H37Rv]
External ID: ALD_INH_FLINT_1536_1X%INH PRUN
Protocol: Assay Overview:

The purpose of this assay is to identify compounds that act as inhibitors of fructose bisphosphate aldolase (FBA) of M. tuberculosis, as monitored by loss (oxidation) of NADH in an enzymatic reaction. Fructose bisphosphate aldolase (FBA) catalyzes the conversion of fructose bisphosphate (FB) into the triose product glyceraldehyde 3 phosphate (G3P) in a reversible fashion. The G3P is converted to dihydroxyacetone phosphate (DHAP) by the helper enzyme triose phosphate isomerase (TPI). A second helper enzyme, glycerol phosphate dehydrogenase (GDH), converts the dihydroxyacetone phosphate to glycerol-3-phosphate with the concomitant oxidation of NADH to NAD, and thus the FBA activity is monitored by the reduction of well fluorescence as measured at 450 nm upon excitation at 340 nm. Compounds are tested in singlicate at a final nominal concentration of 1 uM.

Protocol Summary:

Prior to the start of the assay, 5 uL /well of Buffer A (50 mM HEPES, 0.01% Triton X-100, 10% Glycerol, pH8.0) supplemented with 140 ng/mL FBA, 400 nM ZnCl2, 160 uM NADH and the helper enzymes GDH-TPI (4 U/mL) was dispensed into all wells of a 1536-well plate. Next, 10 nL of test compounds were delivered to each well using a PinTool. DMSO only was dispensed to negative control wells whereas a final concentration of 75 nM of reference compound TD3 was dispensed as a positive control. The assay was then initiated by dispensing 5 uL of Buffer A supplemented with 40 uM of FBP substrate. Plates were incubated at room temperature for 20 minutes before fluorescence was measured (Ex. 340 nm; Em. 450 nm) using the ViewLux plate reader (Perkin Elmer).

The percent inhibition for each compound was calculated as follows:

%_Inhibition = 100 * ( ( Test_Compound - Median_Low_Control ) / ( Median_High_Control - Median_Low_Control ) )

Where:

Test_Compound is defined as wells containing test compound.
Low_Control is defined as wells containing DMSO.
High_Control is defined as wells containing Compound TD3 (75 nM final)

PubChem Activity Outcome and Score:

Two values were calculated: (1) the average percent inhibition of all test compounds and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter. Any compound that exhibited a greater % inhibition than this cutoff parameter was declared active.

Potential fluorescent compounds that showed a percent inhibition value significantly higher than the one calculated for the High_Control (i.e. greater than the average % inhibition +/- 3 S.D. of the High_Control wells) were removed from the hit-cutoff calculation.

The reported PubChem Activity Score has been normalized to 100% observed inhibition. Negative % inhibition values are reported as activity score zero.

The PubChem Activity Score range for active compounds is 100-1, and for inactive compounds 1-0.

List of Reagents:

FBA enzyme (Assay Provider)
ZnCl2 (Fisher Scientific, part Z33-500)
NADH (EMD Biosciences, part 481913)
GDH-TPI (Sigma, part G1881)
HEPES (EMD Biosciences, part EM-5310)
Triton X-100 (Sigma, part T8787)
Glycerol (Fisher, part AC327255000)
Glyceraldehyde-3-phosphate (Sigma, part D7137)
TD3 reference control (Assay Provider)
1536-well plates (Corning, part 7298)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. In this case the results of each separate campaign were assigned 'Active/Inactive" status based upon that campaign's specific compound activity cutoff value. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, and compounds that quench or emit fluorescence within the well. All test compound concentrations reported are nominal; the specific concentration for a particular test compound may vary based upon the actual sample provided by the MLSMR.
Inhibition at 1 uM
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
4.52
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:ICCB-Longwood/NSRB Screening Facility, Harvard Medical School 靶标:N/A
External ID: HMS1364-MLP_ugtP
Protocol: The day before screening, RN4220 ugtP was grown overnight (16-18 h) in sterile-filtered tryptic soy broth (TSB) at 30 degrees C with shaking.

On the day of screening, columns 1-24 of assay plates (Corning 3710, clear) were prefilled with 30 uL of TSB using the Combi. Next, 100 nL of each compound was pin-transferred to each plate. For every compound library plate, there were two daughter plates (A & B). Overnight cultures were diluted 625x into TSB. 50 uL of the diluted cultures were added to columns 1-24 of the corresponding assay plates. Wells in column 2 contained only medium (with culture) and served as the negative controls. Positive control (0.8 uL of erythromycin, 10 ug/mL) was added to column 1 using the D300. Final assay well volume was 80 uL. Plates were spun down and stacked 5 high, covered with lids (Corning 3009), and incubated at 30 degrees C overnight (~16 h).

The following day, assay plates were removed from the incubator and cell density quantitated using a PerkinElmer EnVision (600 nm filter). Library plates were screened in duplicate, with both assay plates in a given set prepared on the same day.
Comment: Z-scores were calculated for every well based on plate average and standard deviation of experimental well absorbance (OD600). Wells were considered active for reduced ugtP survival if Z-score for both replicates < -3 and absorbance for both replicates <= 0.15. Percent inhibition was calculated by subtracting well absorbance from negative control plate average absorbance, dividing by the difference between plate negative and positive control plate average absorbance, and multiplying by 100. The replicate values were then averaged to determine activity scores. Resulting values > 100 were set to 100 and < 0 were set to 0, where 100 = 100% activity.
Absorbance_ugtP_AAbsorbance_ugtP_BZ-score ugtP_AZ-score ugtP_BPercent Inhibition_ugtP_APercent Inhibition_ugtP_B
0.5140.537-1.229512579-0.52346704814.474576278.463841548
0.5470.588-0.7679522420.1914626568.508474576-0.932749885
0.6270.6070.3509819090.457809016-5.95480226-4.433440811
0.6140.6060.1691551090.443790786-3.604519774-4.24919392
0.6040.5740.02928834-0.004792557-1.7966101691.646706587
0.5640.55-0.530178735-0.3412300655.4350282496.068631967
0.6150.5740.183141786-0.004792557-3.7853107341.646706587
0.6170.6130.211115140.541918393-4.146892655-5.538922156
0.6010.604-0.012671690.415754327-1.254237288-3.880700138
0.7040.71.4279560291.761504358-19.87570621-21.56840166
0.6240.6150.3090218780.569954852-5.412429379-5.907415937
0.6450.6110.6027420930.513881934-9.209039548-5.170428374
0.5440.599-0.8099122730.3456631810.06359478-2.989036353
0.5620.617-0.5581520890.5979913116.850384916-6.312752452
0.5490.594-0.7399788880.2755720339.171036483-2.065781881
0.560.63-0.5861254420.7802282947.207408234-8.71321408
0.5690.545-0.46024535-0.4113212125.6008033026.982111945
0.5350.554-0.935792365-0.28515714711.670199715.320253895
0.5170.525-1.187552548-0.69168580214.8834095710.67512983
0.5130.534-1.243499256-0.56552173615.597456219.013271783
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:NCGC 靶标:Smad3 [Homo sapiens]
External ID: SMAD3101
Protocol: Suspensions of trypsinized HEPG2 CAGA-GFP cells were dispensed into white, tissue culture-treated, solid 1536-well plates at 5uL/well (1000 cells/well final concentration) in DMEM medium supplemented with 1% FBS. Plates were incubated at 37 degrees C for 2 hours, after which 23 nL of compounds or DMSO were delivered to each well using a pin tool. One uL of recombinant TGF-beta in DMEM (1% FBS) was then dispensed (500 pg/mL final concentration), and plates were incubated at 37 degrees C for 18 hours. The plates were measured on an Acumen eX3 Explorer plate reader for GFP fluorescence (ex488/em500-530). GFP values were calculated by determining the mean GFP fluorescence of individual cells, and compiling these values for each well to determine a total well GFP signal. The %Activity was determined from the corrected fluorescence values. A titration of the known TGF-B inhibitor SB431542 was included to monitor plate performance, while unstimulated HEPG2 (-TGF-B) control wells were used to normalize %Activity of identified inhibitors; unstimulated wells corresponded to 100%Activity (full inhibition), while stimulated cell controls (+DMSO) were used to normalize 0%Activity (no inhibition).

Concentration-response curves were fitted to the signals arising from the resulting fluorescence. The concentration-effect curves were then classified based on curve quality (r2), response magnitude and degree of measured activity, and compounds were subsequently categorized based on their curve class. Active inhibitors showed concentration-dependent decreases in GFP fluorescence, concordant with a decrease in TGF-B/SMAD3-driven GFP expression. Inactive compounds showed no effect on fluorescence signal.
Comment: Compound Ranking:

1. Compounds are first classified as having full titration curves, partial modulation, partial curve (weaker actives), single point activity (at highest concentration only), or inactive. See data field "Curve Description". For this assay, apparent inhibitors are ranked higher than compounds that showed apparent activation.
2. For all inactive compounds, PUBCHEM_ACTIVITY_SCORE is 0. For all active compounds, a score range was given for each curve class type given above. Active compounds have PUBCHEM_ACTIVITY_SCORE between 40 and 100. Inconclusive compounds have PUBCHEM_ACTIVITY_SCORE between 1 and 39. Fit_LogAC50 was used for determining relative score and was scaled to each curve class' score range.
PhenotypePotencyEfficacyAnalysis CommentCurve_DescriptionFit_LogAC50Fit_HillSlopeFit_R2Fit_InfiniteActivityFit_ZeroActivityFit_CurveClassExcluded_PointsMax_ResponseActivity at 0.018 uMActivity at 0.037 uMActivity at 0.074 uMActivity at 0.164 uMActivity at 0.369 uMActivity at 0.461 uMActivity at 0.737 uMActivity at 0.922 uMActivity at 1.840 uMActivity at 2.300 uMActivity at 3.690 uMActivity at 4.610 uMActivity at 9.231 uMActivity at 20.57 uMActivity at 46.10 uMActivity at 92.20 uMCompound QC
Inactive40 0 0 0 027.05699.939810.15150.16715.572127.0569QC'd by "Asinex Ltd."
Inactive40 0 0 0 1-4.9362-9.41412.0824-11.0493-7.696-4.9362QC'd by "Asinex Ltd."
Inactive40 0 0 0 15.95954.342-1.5624-2.6449-8.95385.9595QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-19.7473-1.4487.5701-38.1554-17.3097-19.7473QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-1.2351-5.5487-5.0573-16.62112.7653-1.2351QC'd by "Asinex Ltd."
Inactive40 0 0 0 07.1959-7.76824.48993.399213.37077.1959QC'd by "Asinex Ltd."
Inactive40 0 0 0 18.983315.3354.25354.1946-14.32368.9833QC'd by "Asinex Ltd."
Inactive40 0 0 0 07.9022-10.517413.4936-10.46867.23237.9022QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-11.834712.2839-2.7256-19.2666-5.8034-11.8347QC'd by "Asinex Ltd."
Inhibitor35.4813106.2444Single point of activity-4.454.44950.9934-109.7251-3.4808-30 0 0 0 0-84.6645-7.4849-2.0755-4.81140.1432-84.6645QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-3.6-2.07174.941415.4055-0.2463-3.6QC'd by "Asinex Ltd."
Inactive40 0 0 0 00.7641028.345612.16980.90780.7641QC'd by "Asinex Ltd."
Inactive40 0 0 0 1-3.7338-9.95590.39868.925512.5033-3.7338QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-1.77973.8831.182-4.1851.7497-1.7797QC'd by "Asinex Ltd."
Inhibitor15.848938.9608Single point of activity-4.83.67720.9889-35.46083.5-30 0 0 0 0-32.8842.06775.8192.7318-1.3119-32.884QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-3.7978.4821-2.183612.765.4907-3.797QC'd by "Asinex Ltd."
Inactive40 0 0 0 0-18.74991.02723.81520.51991.7606-18.7499QC'd by "Asinex Ltd."
Inactive40 0 0 0 00.46409.4101-6.52060.90670.464QC'd by "Asinex Ltd."
Inactive40 0 0 0 00.23719.7122-4.6112-6.6419-3.28890.2371QC'd by "Asinex Ltd."
Inactive40 0 0 0 13.67994.89241.7621-1.6686-4.49453.6799QC'd by "Asinex Ltd."
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:The Scripps Research Institute Molecular Screening Center 靶标:integrase, partial [Human immunodeficiency virus 1]
External ID: LEDGF-p75_INH_TRFRET_1536_3X%INH CRUN
Protocol: Assay Overview:

The purpose of this biochemical assay is to confirm inbitory activity of compounds identified as active in a set of previous experimetns entitled: "TRFRET-based biochemical primary high throughput screening assay to identify inhibitors of HIV-1 LEDGF/p75 DNA Integration" (AID 743269). The main novelty of our approach is to discover new probes that stabilize functionally compromised IN multimers rather than interfere with IN multimerization. Here we refer to such probes as MINIs (multimeric IN inhibitors). Discovery of MINIs through HTS will provide a new and powerful tool for structural and mechanistic studies to elucidate how different multimeric forms of IN interact with viral DNA as well as viral and cellular proteins at different stages of viral replication.

In this assay, test compounds are incubated with IN, followed by addition of DNA Substrates (50nM viral DNA-Cy5, 10nM target DNA substrate final concentrations) and LEDGE/p75 (100nM final concentration). After 30 min incubation Streptavidin-EuCryptate (2nM) is added to the wells. Plates are incubated for 2.5hrs after which HTRF is measured. As designed, compounds that prevent or inhibit IN multimerization will reduce the transfer of energy from Eu to Cy5, thereby inhibiting well FRET. Compounds will be tested in triplicate at a nominal concentration of 3.7 micromolar.

Protocol Summary:

Prior to the start of the assay, 1.5 uL of HIV1-Integrase (100nM final concentration) in assay buffer (20 mM Hepes, pH 7.5, buffer containing 1 mM DTT, 10 mM MgCl2, 10% glycerol, 0.05% Brij-35, 0.1 mg/ml BSA) and 1.5ul of Assay buffer to High Control wells. Next, 11 nl of compounds or DMSO alone (0.25% final concentration) were distributed into appropiate wells. The plates were incubated for 30 minutes at 25 C. The assay started by the addition of 1.5 ul of a mixture containing substrate DNA, viral DNA and LEDGF-p75. The plates were incubated for 2.5hrs at 25 C, after which 3ul of Streptavidin-Eu Cryptate was added to all wells to a final concentration of 1nM in detection buffer (20mM EDTA, 0.05% Brij35, 0.1mg/ml BSA). Plates were incubated for 1 hr, at which time TR-FRET was measured by the ViewLux microplate reader (PerkinElmer). Measurements were performed by exciting the plates at 340 nM, and monitoring well fluorescence at 618 nm (Eu) and 671 nm (Cy5) with the ViewLux microplate reader .

To normalize data, values measured from both fluorescence emission wavelengths were used to calculate a ratio for each well, according to the following mathematical expression:

Ratio = ( I671nm / I618nm )

Where:

I represents the measured fluorescence emission intensity at the enumerated wavelength in nm.

The percent inhibition was calculated from the median ratio as follows:

%_Inhibition = 100 * ( ( Ratio_Test_Compound - Median_Ratio_Low_Control ) / ( Median_Ratio_High_Control - Median_Ratio_Low_Control) ) )

Where:

Test_Compound is defined as wells containing test compound.
High_Control is defined as wells containing HIV1-Integrase and DMSO.
Low_Control is defined as wells containing HIV1-Integrase, vDNA, sDNA, LEDGF-p75 and DMSO
Sample_Field is defined as wells containing HIV1-Integrase, vDNA, sDNA, LEDGF-p75 and compounds in DMSO

PubChem Activity Outcome and Score:

A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Two values were calculated: (1) the average percent inhibition of all compounds tested, and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter, i.e. any compound that exhibited greater % inhibition than the cutoff parameter was declared active.

The reported PubChem Activity Score has been normalized to 100% observed primary inhibition. Negative % inhibition values are reported as activity score zero.

The PubChem Activity Score range for active compounds is 100-13, and for inactive compounds 13-0.

List of Reagents:

HIV-Interase (Supplied by assay provider)
LEDGF-p75 (Suppliedby assay provider)
vDNA (IDT: Custum Oligo-/5#Cy5/ATGTGGAAAATCTCTAGCAGT and /5#Cy5/ACTGCTAGAGATTTTCCACAT)
sDNA (IDT Custom Oligo-ACAGGCCTAGCACGCGTCG/3#Bio/ and CGACGCGTGCTAGGCCTGT/3#Bio/)
Eu-Streptavidin (Cisbio, part number 610SAKLA/B)
HEPES (Sigma Aldrich, part number 83264)
DTT (Sigma Aldrich, part number 16568)
Magnesium chloride (Sigma Aldrich, part number M8266)
glycerol (Sigma Aldrich, part number G7893)
BSA (Sigma Aldrich, part number A7906)
EDTA (Fisher, BP2482)
NaCl (Sigma Aldrich, part number 83264)
1536 well plates (Corning, 7254)
Comment: Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, and compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Average Inhibition at 3.7 uMStandard DeviationInhibition at 3.7 uM [1]Inhibition at 3.7 uM [2]Inhibition at 3.7 uM [3]
93.360.10970667785528593.297813827936293.516147314926693.2713049855983
93.160.29535536451071292.748617564897293.28265896357293.4383159185171
92.940.40171313562283792.464382537853793.447382039406492.9176137643048
92.780.47328469352699292.90903542774293.283510765198192.1461052316698
92.60.33112077746932792.168208180368892.675807625500892.9698595837753
92.40.50631242933815892.58355079734391.710056095522892.9092603284134
91.640.075070068456428191.546326679325891.730077526372191.6321574392054
91.390.48358892370154491.411287014609790.783169184472491.9669769746012
90.820.53691725566366390.671019458098891.540065769808490.2506569441063
90.420.45529923781202989.835207802191690.468373599136290.9468781719333
89.520.57276081230382789.434572967533888.865024795125690.2601854923707
88.920.48596420049564588.501735947772188.659256239604789.6023160078518
88.380.27418358868990888.098454530775188.751717691925788.29006643466
88.161.1124927936295788.142416736638189.532707695834386.8078579870361
88.040.24528220789342488.169672421586688.260709546196287.7008765778634
87.930.66138740992073188.627040192673387.043143103858488.1298837547412
87.360.36283132215246187.083340930815287.121420389743487.8713553176074
87.180.68736039051587188.15297984493286.755914889559186.6406620688546
86.680.22232481080976686.784763714931786.888093386033686.3733738225512
86.240.17572879028780886.0652874523686.482637166007386.182709105399
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:polyadenylate-binding protein 1 [Homo sapiens]
External ID: SBCCG-A704-MLLE-PAM2-Inh-Primary-Assay
Protocol: Assay Materials:
Hepes (Sigma)
NaCl (Sigma)
EDTA (Gibco 15575)
10% Tween 20 (MP biomedicals ICN10316890)
GST-Mlle protein (Assy Provider)
FITC Pam2 peptide (Assay Provider)
Molecular grade water (CellGro 46-000-CM)
Assay plate: Aurora 1536 Black Solid Bottom (00019120BX)

I. Prepare Solutions:
1- Prepare 1Xassay buffer in molecular grade water (20mM Hepes pH 7.4, 150 mM NaCl, 0.5mM EDTA, 0.05% Tween-20)
2- Prepare 2x protein solution (1.35uM) in assay buffer
3- Prepare 2x substrate solution (0.01uM) in assay buffer
II. Compound Addition:
4- Using LabCyte Echo 555, transfer 60 nL from 2 mM compound source plate into assay plate Columns 5-48 (final concentration of test compounds is 20 uM, 1.0% DMSO), and 60 nL of DMSO to control wells in Columns 1-4.
III. Reagent Addition
5- Dispense 3uL/well of assay buffer in columns 1 and 2 and 3ul/well protein solution in columns 3-48 using BiorapTR.
6- Dispense 3ul/well of FITC-PAM2 substrate into all wells using BiorapTR.
9- Spin down plates without lids on Vspin at 1000 rpm for 1 min
10- incubate plates at room temp for 2 hours.
IV. Reading plates:
11- Read the plate on PerkinElmer-EnVision plate reader FP protocol with dual mirror
Comment: The experimental values were normalized by difference between values from neutral and stimulator control wells in each plate. Then normalized data was corrected to remove systematic plate patterns due to artifacts such as dispensing tip issues etc. Further information about data correction is available at http://www.genedata.com/products/screener.html.

Compounds that demonstrated % activity of >= 40 and F-ratio between 0.5 and 1.5 at 20 uM in either normalized or corrected results are defined as active in this assay.

To simplify the distinction between the inactives of the primary screen and of the confirmatory screening stage, the Tiered Activity Scoring System was developed and implemented.

Activity Scoring
Activity scoring rules were devised to take into consideration compound efficacy, its potential interference with the assay and the screening stage that the data was obtained. Details of the Scoring System will be published elsewhere. Briefly, the outline of the scoring system utilized for the assay is as follows:
1) First tier (0-40 range) is reserved for primary screening data. The score is correlated with % activity in the assay:
a. If outcome of the primary screen is inactive, then the assigned score is 0
b. If outcome of the primary screen is inconclusive, then the assigned score is 10
c. If outcome of the primary screen is active, then the assigned score is 20
Scoring for Single concentration confirmation screening is not applicable to this assay.
d. If outcome of the single-concentration confirmation screen is inactive, then the assigned score is 21
e. If outcome of the single-concentration confirmation screen is inconclusive, then the assigned score is 25
f. If outcome of the single-concentration confirmation screen is active, then the assigned score is 30
This scoring system helps track the stage of the testing of a particular SID. For the primary hits which are available for confirmation, their scores will be greater than 20. For those which are not further confirmed, their score will stay under 21.

2) Second tier (41-80 range) is reserved for dose-response confirmation data and is not applicable in this assay

3) Third tier (81-100 range) is reserved for resynthesized true positives and their analogues and is not applicable in this assay
%Activity at 20 uMFRatio%Activity at 20 uM_CorrFRatio_CorrValueMean HighSTD Deviation HighMean LowSTD Deviation Low
150.8414.860.8550843144.5159.087.8961.937.79
9.90.838.930.8465315149.5159.087.8961.937.79
10.70.838.720.8463278148.7159.087.8961.937.79
-14.30.88-15.340.8966855173159.087.8961.937.79
9.10.836.380.8458876150.2159.087.8961.937.79
-32.40.69-36.820.7076997190.6159.087.8961.937.79
1.50.84-0.940.8554303157.6159.087.8961.937.79
6.90.824.430.8332459152.4159.087.8961.937.79
00.81-3.790.8271697159.1159.087.8961.937.79
-1.90.83-5.390.8443624160.9159.087.8961.937.79
1.60.81-1.310.8225578157.5159.087.8961.937.79
14.30.8511.490.8618813145.2159.087.8961.937.79
-9.20.88-120.8925302168159.087.8961.937.79
-2.80.82-7.720.8310372161.8159.087.8961.937.79
19.90.8616.140.8721381139.7159.087.8961.937.79
5.10.836.880.8452045154.1159.087.8961.937.79
6.70.837.670.8421595152.6159.087.8961.937.79
40.834.340.8462754155.2159.087.8961.937.79
8.80.836.730.8401095150.5159.087.8961.937.79
-100.82-10.760.833463168.8159.087.8961.937.79
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:N/A
External ID: SBCCG-A705-H9c2-Inh-Primary-Assay
Protocol: Assay Materials:
H9c2 Embryonic Myocardium Cells (ATCC CRL-1446)
DMEM (Mediatech 10-013-CM)
DMEM (no phenol red) (Mediatech 17-205-CV)
Fetal Bovine Serum (Hyclone KTL33155)
Penicillin Streptomycin solution Gibco (Invitrogen 667539)
L-glutamine (100X ) Gibco (Invitrogen 25030)
Trypsin-EDTA 0.25% Gibco (Invitrogen 25200)
Hydrogen Peroxide (Macron Chemicals V340-04)
T75 Tissue Culture flasks (75cm2) Corning #3276
T225 Tissue Culture flasks (225cm2) Corning #3293
ATP Lite 1-Step (PerkinElmer 6016739)
PBS (Mediatech 21-031-CV)
1536 well white High Base plate (Aurora Biotechnology 00019130)

I. Compound Addition:
1- Using LabCyte Echo 555, transfer 50 nL from 2 mM compound source plate into assay plate Columns 5-48 (final concentration of test compounds is 20 uM, 1.0% DMSO), and 50 nL of DMSO to control wells in Columns 1-4.
II. Cell Suspension
2-Dispense 3 uL/well of cells using Combi at 1.67X10;5 cells/mL (500 cells/well).
3-Spin down plates on Eppendorf centrifuge 5810 at 1200 rpm for 1 minute.
4-Put Kalypsys metal lids on plates, and incubate plates at 37 degrees C with 5% CO2 for 60 min.
III. Reagent Addition
5-Add 2 uL/well of assay medium to columns 1-2 and 2 uL/well of 1mM H2O2 in assay medium to columns 3-48 of the assay plates using Combi.
6-Incubate plates in CO2 incubator for 2 hours.
7-Open the lid and leave the plate at room temp for 10 min.
8-Add 3uL/well of ATP Lite 1 Step mix using Combi.
9-Spin down plates on Eppendorf centrifuge 5810 without the lid at 2000 rpm for 2 minutes.
10-Cover with black lid and leave the plate at 10 minutes at room temp.
IV. Reading plates:
11- Read the plate on PerkinElmer Viewlux.
Comment: Compounds that demonstrated corrected or uncorrected % activity of >= 50 compared to the controls are defined as inhibitors of the reaction.

The experimental values were normalized by the difference between values from neutral and stimulator control wells in each plate. Then normalized data was corrected to remove systematic plate patterns due to artifacts such as dispensing tip issues etc. Further information about data correction is available at http://www.genedata.com/products/screener.html.

To simplify the distinction between the inactives of the primary screen and of the confirmatory screening stage, the Tiered Activity Scoring System was developed and implemented.

Activity Scoring
Activity scoring rules were devised to take into consideration compound efficacy, its potential interference with the assay and the screening stage that the data was obtained. Details of the Scoring System will be published elsewhere. Briefly, the outline of the scoring system utilized for the assay is as follows:
1) First tier (0-40 range) is reserved for primary screening data. The score is correlated with % activity in the assay:
a. If outcome of the primary screen is inactive, then the assigned score is 0
b. If outcome of the primary screen is inconclusive, then the assigned score is 10
c. If outcome of the primary screen is active, then the assigned score is 20
Scoring for Single concentration confirmation screening is not applicable to this assay.
d. If outcome of the single-concentration confirmation screen is inactive, then the assigned score is 21
e. If outcome of the single-concentration confirmation screen is inconclusive, then the assigned score is 25
f. If outcome of the single-concentration confirmation screen is active, then the assigned score is 30
This scoring system helps track the stage of the testing of a particular SID. For the primary hits which are available for confirmation, their scores will be greater than 20. For those which are not further confirmed, their score will stay under 21.

2) Second tier (41-80 range) is reserved for dose-response confirmation data and is not applicable in this assay

3) Third tier (81-100 range) is reserved for resynthesized true positives and their analogues and is not applicable in this assay
%Activity at 20 uM%Activity at 20 uM_CorrValueMean HighSTD Deviation HighMean LowSTD Deviation Low
62.165.11033.74430.5868.371401.35118.28
52.453.4962.08462.6292.241415.9897.61
46.451.6905.42462.6292.241415.9897.61
65.969.91107.4440.4963.121452.9137.7
58.261.21029.63440.4963.121452.9137.7
53.555.31023.15465.0765.721507.58140.25
56.456.4993.78393.9266.251456.86145.67
78.979.41232.45393.9266.251456.86145.67
8383.31315.03456.8870.631491.39124.66
81.283.21296.86456.8870.631491.39124.66
57.360.21049.86456.8870.631491.39124.66
58.661.51062.63456.8870.631491.39124.66
49.150.4965.03456.8870.631491.39124.66
56.959.2853.95183.7834.741361.54139.33
52.654.5802.82184.9342.941358.8899.89
57.656.7836.33193.8439.581308.77106.85
62.761.3893.37193.8439.581308.77106.85
61.762.8908.14203.7844.071345.21119.49
58.258.4867.95203.7844.071345.21119.49
6863.9980.14203.7844.071345.21119.49
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:PSMD14 protein [Homo sapiens]
External ID: SBCCG-A706-Rpn11-Inh-Primary-Assay
Protocol: Assay materials:
1) Ub4-pepOG protein substrate was provided by Dr. Deshaies laboratory
2) 26S proteasome from human erythrocytes (Cat # PW9310) and Epoxomicin (Cat # BML-PI127-0100) were purchased from BioMol/ENZO Life Sciences
3) Assay Buffer: 50 mM Tris-HCl pH 8.0 , 0.05 mM ATP, 0.05 mM Magnesium Chloride,
1 mM DTT, 0.01% NP-40
4) Epoxomicin Solution: 1.5 uM Epoxomicin in 1x Assay Buffer
5) Aurora 1536 well black high base plate were obtained from Nexus Biosystems (Cat # 00019120BX)

uHTS Procedure

1) Using LabCyte Echo, transfer 40 nL of test compounds from a 2 mM compound source plate into assay plate Cols. 5-48 (final concentration of test compounds is 20 uM, 1 % DMSO). Transfer 40 nL of 100% DMSO into assay plate Col. 1-4.
2) Pre-incubate 20nM 26S proteasome in Epoxomicin Solution at room temperature for 1 hour, then dilute 10-fold in pre-chilled 1x Assay Buffer.
3) Using Beckman BiorapTR dispense 2uL of Assay Buffer in columns 1 and 2, and 2uL of 26S proteasome solution to columns 3-48.
4) Using Beckman BiorapTR dispense 2ul of Ub4-pepOG substrate into all wells (columns 1-48)
5) Spin plates at 1500 rpm for 1 minute on Eppendorf centrifuge 5810.
6) Incubate for 80 minutes at room temp.
7) Read plates on Perkin Elmer Envision with dual mirror at Ex/Em 480/535 nm in fluorescent polarization mode
Comment: Compounds that demonstrated a normalized or corrected inhibition of >= 40% at 20uM concentration are defined as actives in this assay.

The experimental values were normalized by the difference between values from neutral and stimulator control wells in each plate. Then normalized data was corrected to remove systematic plate patterns due to artifacts such as dispensing tip issues etc. Further information about data correction is available at http://www.genedata.com/products/screener.html.

To simplify the distinction between the inactives of the primary screen and of the confirmatory screening stage, the Tiered Activity Scoring System was developed and implemented.

Activity Scoring
Activity scoring rules were devised to take into consideration compound efficacy, its potential interference with the assay and the screening stage that the data was obtained. Details of the Scoring System will be published elsewhere. Briefly, the outline of the scoring system utilized for the assay is as follows:
1) First tier (0-40 range) is reserved for primary screening data. The score is correlated with % activity in the assay:
a. If outcome of the primary screen is inactive, then the assigned score is 0
b. If outcome of the primary screen is inconclusive, then the assigned score is 10
c. If outcome of the primary screen is active, then the assigned score is 20
Scoring for Single concentration confirmation screening is not applicable to this assay.
d. If outcome of the single-concentration confirmation screen is inactive, then the assigned score is 21
e. If outcome of the single-concentration confirmation screen is inconclusive, then the assigned score is 25
f. If outcome of the single-concentration confirmation screen is active, then the assigned score is 30
This scoring system helps track the stage of the testing of a particular SID. For the primary hits which are available for confirmation, their scores will be greater than 20. For those which are not further confirmed, their score will stay under 21.

2) Second tier (41-80 range) is reserved for dose-response confirmation data and is not applicable in this assay

3) Third tier (81-100 range) is reserved for resynthesized true positives and their analogues and is not applicable in this assay
%Activity at 20 uM_Norm%Activity at 20 uM_CorrFRatioValueMean HighSTD Deviation HighMean LowSTD Deviation Low
63.673671.4589150.69103.914.1176.784.39
230.78231.30.78295271.74103.914.1176.784.39
41.77632.81.2003136.08105.55.49176.944.9
46.91237.41.3572139.3104.455.61176.634.73
55.55655.61.2574146.04107.435.95175.56.49
81.25879.61.4957162.9107.435.95175.56.49
59.489541.3115148.62107.435.95175.56.49
51.58641.2922143.23104.976.39177.746.04
31.71945.41.235128.9104.976.39177.746.04
61.82371.61.4534150.62104.976.39177.746.04
57.953.80.8445147.79104.976.39177.746.04
48.00941.41.1163138.91102.974.29177.384.55
63.529570.83021150.37102.974.29177.384.55
41.60340.81.3092134.18102.974.29177.384.55
43.71750.51.211148.51126.065.04177.934.95
46.83234.71.2735150.09126.065.04177.934.95
51.28643.30.95773152.35126.065.04177.934.95
51.10441.51.1854141.85106.434.27176.764.46
123.45128.51.0977196.07110.274.81179.075.64
44.29639.81.4144140.05109.074.89177.275.02
HepG2 Cytotoxicity Assay Measured in Cell-Based System Using Plate Reader - 7071-02_Inhibitor_Dose_DryPowder_Activity_Set16
来源:Burnham Center for Chemical Genomics 靶标:tyrosine-protein phosphatase non-receptor type 5 isoform a [Homo sapiens]
External ID: SBCCG-A754-STEP-Primary-Assay
Protocol: STEP Assay HTS Protocol

A. Brief Description of the Assay:
This assay idenitfies inhibitors of STEP (STriatal-Enriched Phosphatase) enzyme. It is measured via fluorescence in 1536-well plate format.

B. Materials:
Item, Source, Cat #
STEP Enzyme Stock Solution 6.2mg/mL (178uM), Dr. Lutz Tautz, N/A
Bis-Tris, Fisher Sci, BP301-100
Tween 20, Sigma, P1379
DTT, Sigma, D9779
OMFP, Sigma, M2629-100MG
Mol. Grade Water, Mediatech, Inc., 46-000-CM
1536 well black solid flat bottom Non-Binding plate, Corning, 3724

C. Final Assay Conditions:
Reagent, Final Concentration
BIS-TRIS pH 6.0, 50 mM
Tween 20, 0.005 %
DTT, 2.5 mM
STEP, 0.5 nM
OMFP, 25 uM
Final reaction volume, 4 uL/well in 1536 well plate
Test compound concentration, 20 uM
Final DMSO concentration, 1.0%
D. Procedures:
Step#, Description
1. Prepare Reagents as described in sections F. Recipe.
2. Using LabCyte Echo, transfer 40 nL from a plate containing 2 mM test compounds into assay plate Col. 5 - 44 (final concentration of test compounds is 20 uM, 1.0% DMSO). 40nL of DMSO should be transferred to col. 1-4 for control wells.
3. Spin plates at 1000 rpm for 1 minute in centrifuge.
4. Set up Kalypsys dispenser as described in section G. Instrument settings.
5. Using the Kalypsys dispenser, add 2 uL/well of control buffer (no enzyme control) to columns 1 and 2 for the positive control wells.
6. Using the Kalypsys dispenser, add 2 uL/well of enzyme solution to col. 3-48 for the negative control and test compound wells.
7. Using the Kalypsys dispenser, add 2 uL/well of substrate solution to columns. 1-48 (all wells).
8. Spin plates at 1000 rpm for 1 minute in centrifuge.
9. Incubate plates in the dark at room temperature for 20 minutes.
10. Detect signals on Perkin Elmer Viewlux with settings as described in section G. Instrument settings.

E. Plate Map:
Positive (Low) control in columns 1 - 2, DMSO, substrate only
Negative (High) control in columns 3 and 4, DMSO, enzyme and substrate
Test compound in columns 5 - 48, Test compounds, enzyme and substrate

F. Recipe:
Enzyme solution (STEP)
Reagent, Working Conc.
BIS-TRIS pH 6.0, 50 mM
Tween 20, 0.005 %
DTT, 5 mM
STEP, 0.5 nM

Substrate solution (OMFP)
Reagent, Working Conc.
BIS-TRIS pH 6.0, 50 mM
Tween 20, 0.005 %
OMFP, 50uM

G. Instrument settings:
Kalypsys dispenser
Step#, Description
1. Before assay starts, rinse tubing thoroughly with 5 mL of MilliQ H2O per dispensing tip.
2. Air rinse tubing.
3. Rinse and prime tubing with 1 mL of actual reagents per dispensing tip.
4. When the assay is done, clean tubing thoroughly with 5 mL of MilliQ H2O per dispensing tip.
5. Air rinse tubing.
6. Rinse tubing thoroughly with 5 mL of 25% EtOH per dispensing tip.

Perkin Elmer Viewlux
Light Energy: 10000
Measurement: Time 1 sec.
Excitation Filter: 480/20 (FITC)
Emission Filter: 540/25 (FITC)
Mirror: FITC dichroic
Sensitivity: 4.13 e - /ADU

H. Note:
1. All reagents should be made up according to its spec-sheet or otherwise in Mol. Grade Water.
2. Make up buffer minus Tween-20 in large scale and add fresh Tween-20 weekly.
3. Make up enzyme buffer minus DTT in large scale and add fresh DTT just before the assay starts.
4. Storage conditions after reagents are made up:
Reagent, Temp.
Buffer minus DTT, 4 degree
STEP, -80 degrees
Na3VO4, -80 degrees
DTT, -80 degrees
OMFP, -80 degrees (light sensitive)

The experimental values were normalized by difference between values from neutral and stimulator control wells in each plates. Then normalized data was corrected to remove systematic plate patterns due to artifacts such as dispensing and edge effect due to overnight incubation. The algorism "Assay Pattern (Multiplicative)" was applied in Genedata Screener(R) software to correct screen data. Further information about data correction is available at http://www.genedata.com/products/screener.html.
Compounds that demonstrated % activity of >= 40 % at 20 uM
Comment: Compounds that demonstrated a normalized or corrected inhibition of >= 40% at 20uM concentration are defined as actives in this assay.

The experimental values were normalized by the difference between values from neutral and stimulator control wells in each plate. Then normalized data was corrected to remove systematic plate patterns due to artifacts such as dispensing tip issues etc. Further information about data correction is available at http://www.genedata.com/products/screener.html.

To simplify the distinction between the inactives of the primary screen and of the confirmatory screening stage, the Tiered Activity Scoring System was developed and implemented.

Activity Scoring
Activity scoring rules were devised to take into consideration compound efficacy, its potential interference with the assay and the screening stage that the data was obtained. Details of the Scoring System will be published elsewhere. Briefly, the outline of the scoring system utilized for the assay is as follows:
1) First tier (0-40 range) is reserved for primary screening data. The score is correlated with % activity in the assay:
a. If outcome of the primary screen is inactive, then the assigned score is 0
b. If outcome of the primary screen is inconclusive, then the assigned score is 10
c. If outcome of the primary screen is active, then the assigned score is 20
Scoring for Single concentration confirmation screening is not applicable to this assay.
d. If outcome of the single-concentration confirmation screen is inactive, then the assigned score is 21
e. If outcome of the single-concentration confirmation screen is inconclusive, then the assigned score is 25
f. If outcome of the single-concentration confirmation screen is active, then the assigned score is 30
This scoring system helps track the stage of the testing of a particular SID. For the primary hits which are available for confirmation, their scores will be greater than 20. For those which are not further confirmed, their score will stay under 21.

2) Second tier (41-80 range) is reserved for dose-response confirmation data and is not applicable in this assay

3) Third tier (81-100 range) is reserved for resynthesized true positives and their analogues and is not applicable in this assay
%Activity at 20 uM_Norm%Activity at 20 uM_CorrValueMean Low Std Deviation Low Mean High Std Deviation High
-5.04020.34284.911163.5125.634134.15121.83
-1.33162.64174.771163.5125.634134.15121.83
-4.81970.34278.361163.5125.634134.15121.83
1.77943.44082.381163.5125.634134.15121.83
-1.2535-1.54172.451163.5125.634134.15121.83
-4.9399-4.24281.931163.5125.634134.15121.83
-7.5121-2.84358.321163.5125.634134.15121.83
-4.33780.14264.051163.5125.634134.15121.83
-6.0925-2.14316.161163.5125.634134.15121.83
-6.1417-3.14317.621163.5125.634134.15121.83
-6.5477-3.94329.681163.5125.634134.15121.83
-3.7859-1.34247.661163.5125.634134.15121.83
11.6934.93787.961163.5125.634134.15121.83
-4.1853-3.64259.521163.5125.634134.15121.83
1.93570.54077.741163.5125.634134.15121.83
-3.2081-0.14230.51163.5125.634134.15121.83
-3.14251.14228.551163.5125.634134.15121.83
-5.89921.64310.421163.5125.634134.15121.83
-11.516-0.44477.221163.5125.634134.15121.83
-12.486-5.94506.021163.5125.634134.15121.83